Transcript asmbl_99877

Sequence
Transcript Sequence for observation asmbl_99877 of TGE0059719:
AGAAGAACCATGAGGCTCATCCTGCCTGTGGGTTTGATTGCTACCACTCTTGCAATTGCTCCTGTCCGCTTTGACAGGGAGAAGGTGTTCCGCGTGAAGCCCCAGGATGAAAAACAAGCAGACATCATAAAGGACTTGGCCAAAACCAATGAGCTTGACTTCTGGTATCCAGGTGCCACCCACCACGTAGCTGCTAATATGATGGTGGATTTCCGAGTTAGTGAGAAGGAATCCCAAGCCATCCAGTCTGCCTTGGATCAAAATAAAATGCACTATGAAATCTTGATTCATGATCTACAAGAAGAGATTGAGAAACAGTTTGATGTTAAAGAAGATATCCCAGGCAGGCACAGCTACGCAAAATACAATAATTGGGAAAAGATTGTGGCTTGGACTGAAAAGATGATGGATAAGTATCCTGAAATGGTCTCTCGTATTAAAATTGGATCTACTGTTGAAGATAATCCACTATATGTTCTGAAGATTGGGGAAAAGAATGAAAGAAGAAAGGCTATTTTTACGGATTGTGGCATTCACGCACGAGAATGGGTCTCCCCAGCATTCTGCCAGTGGTTTGTCTATCAGGCAACCAAAACTTATGGGAGAAACAAAATTATGACCAAACTCTTGGACCGAATGAATTTTTACATTCTTCCTGTGTTCAATGTTGATGGATATATTTGGTCATGGACAAAGAACCGCATGTGGAGAAAAAATCGTTCCAAGAACCAAAACTCCAAATGCATCGGCACTGACCTCAACAGGAATTTTAATGCTTCATGGAACTCCATTCCTAACACCAATGACCCATGTGCAGATAACTATCGGGGCTCTGCACCAGAGTCCGAGAAAGAGACGAAAGCTGTCACTAATTTCATTAGAAGCCACCTGAATGAAATCAAGGTTTACATCACCTTCCATTCCTACTCCCAGATGCTATTGTTTCCCTATGGATATACATCAAAACTGCCACCTAACCATGAGGACTTGGCCAAAGTTGCAAAGATTGGCACTGATGTTCTATCAACTCGATATGAAACCCGCTACATCTATGGCCCAATAGAATCAACAATTTACCCGATATCAGGTTCTTCTTTAGACTGGGCTTATGACCTGGGCATCAAACACACATTTGCCTTTGAGCTCCGAGATAAAGGCAAATTTGGTTTTCTCCTTCCAGAATCCCGGATAAAGCCAACGTGCAGAGAGACCATGCTAGCTGTCAAATTTATTGCCAAGTATATCCTCAAGCATACTTCCTAAAGAACTGCCCTCTGTTTGGAATAAGCCAATTAATCCTTTTTTGTGCCTTTCATCAGAAAGTCAATCTTCAGTTATCCCCAAATGCAGCTTCTATTTCACCTGAATCCTTCTCTTGCTCATTTAAGTCCCATGTTACTGCTGTTTGCTTTTACTTACTTTCAGTAGCACCATAACGAAGTAGCTTTAAGTGAAACCTTTTAACTACCTTTCTTTGCTCCAAGTGAAGTTTGGACCCAGCAGAAAGCATTATTTTGAAAGGTGATATACAGTGGGGCACAGAAAACAAATGAAAACCTTCAGTTTCTCACAGATTTTCACCATGTGGCTTCATCAATTTATGTGCTAATACAATAAAATAAAATGCACTTAATGCTTTAAAATTCATCTTTTTATGATAAACTATATTCTCTGTATTTCTCTATAGCATTAATAATCAATATTAATGCCATTCATTCAGTCTGTTAATAAGAAATAATATCTTCAATTTTCAAAAACATAATTTGTCTATCTTTTTCTGATAGAAGTAGACATTGTTTATATCTTCAAAAAAGCAAAAGGATGTCCTAGCAGGAAATAAAGTGGTTCATATA