Transcript asmbl_99441

Sequence
Transcript Sequence for observation asmbl_99441 of TGE0059717:
GCGCGGCCAGGGGCGGGCGGCCGCAGAGCAGCACCGGCCGTGGCTCCGGTAGCAGCAAGTTCGAACCCCGCTCCCGCTCCGCTTCGGTTCTCGCTCCTTCGGCCCTTGGGCCTCCAAACACCAGTCCCCGGCAGCTCGTTGCGCATTGCGCTCTCCCCGCCACCAGGATGCCGGTAACCGAGAAGGATCTAGCTGAGGACGCGCCTTGGAAGAAGATCCAGCAGAACACGTTCACACGCTGGTGCAACGAGCACCTCAAGTGCGTGAACAAACGCATCGGCAACCTGCAGACCGACCTGAGCGACGGGCTGCGGCTCATCGCGCTGCTCGAGGTGCTCAGCCAGAAGCGCATGTACCGCAAGTACCATCAGCGGCCCACCTTTCGCCAGATGCAGCTCGAGAATGTGTCCGTGGCGCTCGAGTTCCTGGACCGTGAGAGCATCAAGCTCGTGTCCATCGATAGCAAAGCCATTGTGGATGGGAACCTGAAGCTCATCTTGGGTCTGGTGTGGACGCTGATCCTCCACTACTCCATCTCCATGCCCGTGTGGGAGGATGAAGGGGATGATGATGCCAAGAAGCAGACGCCAAAGCAGAGGCTGCTGGGGTGGATTCAGAACAAGATCCCCTACTTGCCCATCACCAACTTTAACCAGAACTGGCAAGACGGCAAAGCCCTGGGAGCCCTGGTAGACAGCTGTGCTCCAGGTCTGTGCCCAGACTGGGAATCCTGGGACCCGCAGAAGCCTGTGGATAATGCACGAGAAGCCATGCAGCAGGCAGATGACTGGCTGGGTGTCCCACAGGTCATCACTCCTGAAGAAATCATTCACCCGGATGTGGACGAGCACTCAGTTATGACTTACCTGTCCCAGTTCCCCAAAGCCAAGCTCAAGCCGGGGGCTCCTCTCAAACCCAAACTCAACCCGAAGAAAGCCAGGGCCTATGGCAGAGGAATCGAGCCCACTGGAAACATGGTGAAGCAGCCAGCCAAGTTCACTGTGGACACCATCAGCGCCGGGCAAGGAGACGTGATGGTGTTTGTTGAGGACCCAGAAGGGAACAAAGAGGAGGCACAAGTGACCCCTGACAGTGACAAGAACAAGACATACTCTGTGGAGTATCTGCCCAAGGTCACCGGGCTACACAAAGTCACAGTCCTCTTTGCAGGACAGCACATCTCCAAGAGCCCATTTGAAGTGAGTGTTGACAAGGCCCAGGGAGATGCCAGTAAAGTCACTGCAAAAGGTCCAGGGTTGGAAGCTGTAGGGAACATCGCCAATAAGCCCACCTACTTTGACATCTATACGGCAGGAGCTGGTGTGGGTGACATTGGTGTGGAGGTGGAAGATCCCCAGGGGAAGAACACCGTGGAGTTGCTCGTGGAAGACAAAGGAAACCAGGTGTATCGATGTGTGTACAAACCCATGCAGCCTGGCCCTCACGTGGTCAAGATCTTCTTTGCTGGGGACACTATTCCTAAGAGTCCCTTCGTTGTGCAGGTTGGGGAAGCCTGCAATCCAAATGCCTGCCGGGCCAGTGGCCGAGGCCTACAACCCAAAGGCGTCCGTATCCGGGAGACCACAGATTTCAAGGTTGACACCAAAGCTGCAGGAAGTGGGGAGCTCGGTGTAACCATGAAGGGTCCTAAGGGTCTGGAGGAGCTGGTGAAGCAGAAAGACTTTCTGGATGGGGTCTACGCATTCGAGTATTACCCCAGCACCCCGGGGAGATACAGCATTGCCATCACATGGGGGGGACACCACATTCCAAAGAGCCCCTTTGAAGTTCAAGTTGGCCCTGAAGCGGGTATGCAGAAAGTCCGTGCTTGGGGCCCTGGGCTCCATGGTGGGATTGTCGGGCGGTCAGCGGACTTCGTGGTAGAATCCATTGGCTCTGAAGTGGGGTCTCTGGGGTTTGCCATTGAAGGCCCCTCTCAGGCAAAGATTGAGTACAACGACCAGAATGATGGATCGTGTGATGTCAAATACTGGCCCAAGGAGCCTGGCGAATATGCTGTTCACATCATGTGTGACGACGAAGACATCAAGGACAGCCCGTACATGGCCTTCATCCACCCAGCCACGGGAGGCTACAACCCTGATCTGGTTCGAGCATACGGGCCAGGTTTGGAGAAATCTGGATGCATTGTCAACAACCTGGCCGAGTTCACTGTGGATCCTAAGGATGCTGGAAAAGCTCCCTTAAAGATATTTGCTCAGGATGGGGAAGGCCAACGCATTGACATCCAGATGAAGAACCGGATGGACGGCACATATGCATGCTCATACACCCCGGTGAAGGCCATCAAGCACACCATTGCTGTGGTCTGGGGAGGCGTGAACATCCCGCACAGCCCCTACAGGGTCAACATCGGGCAAGGTAGCCATCCTCAGAAGGTCAAAGTGTTTGGGCCAGGTGTGGAGAGAAGTGGTCTGAAGGCAAATGAACCTACACACTTCACGGTGGACTGTACTGAGGCTGGGGAAGGTGATGTCAGTGTTGGCATTAAGTGTGATGCCCGGGTGTTAAGTGAAGATGAGGAAGACGTGGATTTTGACATTATTCACAATGCCAATGATACGTTCACAGTCAAATATGTGCCTCCTGCTGCTGGGCGATACACTATCAAAGTTCTCTTTGCATCTCAGGAAATCCCCGCCAGCCCTTTCAGAGTCAAAGTTGACCCTTCCCACGATGCCAGCAAAGTGAAGGCAGAAGGCCCAGGGCTCAGCAAAGCAGGTGTGGAAAATGGGAAACCGACCCACTTCACTGTCTACACCAAGGGGGCTGGGAAAGCCCCGCTCAACGTGCAGTTCAACAGCCCTCTTCCTGGCGATGCAGTGAAGGATTTGGATATCATCGATAATTATGACTACTCTCACACGGTTAAATATACACCCACCCAACAGGGCAACATGCAGGTTCTGGTGACTTACGGTGGCGATCCCATCCCTAAAAGCCCTTTCACTGTGGGTGTTGCTGCACCGCTGGATCTGAGCAAGATAAAACTCAATGGGCTGGAAAACAGGGTGGAAGTTGGGAAGGATCAGGAGTTCACCGTTGATACCAGGGGGGCAGGAGGCCAGGGGAAGCTGGACGTGACAATCCTCAGCCCCTCTCGGAAGGTCGTGCCATGCCTAGTGACACCTGTGACAGGCCGGGAGAACAGCACGGCCAAGTTCATCCCTCGGGAGGAGGGGCTGTATGCTGTAGACGTGACCTACGATGGACACCCTGTGCCCGGGAGCCCCTACACAGTGGAGGCCTCGCTGCCACCAGATCCCAGCAAGGTGAAGGCCCACGGTCCCGGCCTCGAAGGTGGTCTCGTGGGCAAGCCTGCCGAGTTCACCATCGATACCAAAGGAGCTGGTACTGGAGGTCTGGGCTTAACGGTGGAAGGTCCGTGCGAGGCCAAAATCGAGTGCTCCGACAATGGTGATGGGACCTGCTCCGTCTCTTACCTTCCCACAAAACCCGGGGAGTACTTCGTCAACATCCTCTTTGAAGAAGTCCACATACCTGGGTCTCCCTTCAAAGCTGACATTGAAATGCCCTTTGACCCCTCTAAAGTCGTGGCATCGGGGCCAGGTCTCGAGCACGGGAAGGTGGGTGAAGCTGGCCTCCTTAGCGTCGACTGCTCGGAAGCGGGACCGGGGGCCCTGGGCCTGGAAGCTGTCTCGGACTCGGGAACAAAAGCCGAAGTCAGTATTCAGAACAACAAAGATGGCACCTACGCGGTGACCTACGTGCCCCTGACGGCCGGCATGTACACGTTGACCATGAAGTATGGTGGCGAACTCGTGCCACACTTCCCCGCCCGGGTCAAGGTGGAGCCCGCCGTGGACACCAGCAGGATCAAAGTCTTTGGACCAGGAATAGAAGGGAAAGATGTGTTCCGGGAAGCTACCACCGACTTTACAGTTGACTCTCGGCCGCTGACCCAGGTTGGGGGTGACCACATCAAGGCCCACATTGCCAACCCCTCAGGGGCCTCCACCGAGTGCTTTGTCACAGACAATGCGGATGGGACCTACCAGGTGGAATACACACCCTTTGAGAAAGGTCTCCATGTAGTGGAGGTGACATATGATGACGTGCCTATCCCAAACAGTCCCTTCAAGGTGGCTGTCACTGAAGGCTGCCAGCCATCTAGGGTGCAAGCCCAAGGACCTGGATTGAAAGAGGCCTTTACCAACAAGCCCAATGTCTTCACCGTGGTTACCAGAGGCGCAGGAATTGGTGGGCTTGGCATAACTGTTGAGGGACCATCAGAGTCGAAGATAAATTGCAGAGACAACAAGGATGGCAGCTGCAGTGCTGAGTACATTCCTTTCGCACCGGGGGATTACGATGTTAATATCACATATGGAGGAGCCCACATCCCCGGCAGCCCCTTCAGGGTTCCTGTGAAGGATGTTGTGGACCCCAGCAAGGTCAAGATTGCCGGCCCCGGGCTGGGCTCAGGCGTCCGAGCCCGTGTCCTGCAGTCCTTCACGGTGGACAGCAGCAAGGCTGGCCTGGCTCCGCTGGAAGTGAGGGTTCTGGGCCCACGAGGCTTGGTGGAGCCAGTGAACGTGGTGGACAATGGAGATGGCACACACACAGTAACCTACACCCCATCTCAGGAGGGACCTTACATGGTCTCAGTTAAATATGCTGATGAAGAGATTCCTCGCAGTCCCTTCAAGGTCAAGGTCCTTCCCACATATGATGCCAGCAAAGTGACTGCCAGTGGCCCCGGCCTTAGTTCCTATGGTGTGCCTGCCAGTCTACCTGTGGACTTTGCAATTGATGCCCGAGATGCCGGGGAAGGCCTGCTTGCTGTTCAAATAACGGACCAAGAAGGAAAACCCAAAAGAGCCATTGTCCATGACAATAAAGATGGCACGTATGCTGTCACCTACATCCCCGACAAGACTGGGCGCTATATGATTGGAGTCACCTACGGGGGTGACGACATCCCACTTTCTCCTTATCGCATCCGAGCCACACAGACGGGTGATGCCAGCAAGTGCCTGGCCACGGGTCCTGGAATCGCCTCCACTGTGAAAACTGGCGAAGAAGTAGGCTTTGTGGTTGATGCCAAGACTGCCGGGAAGGGTAAAGTGACCTGCACGGTTCTGACCCCAGATGGCACTGAGGCCGAGGCCGATGTCATTGAGAATGAAGATGGAACCTATGACATCTTCTACACAGCTGCCAAGCCGGGCACATATGTGATCTATGTGCGCTTCGGTGGTGTTGATATTCCTAACAGCCCCTTCACTGTCATGGCCACAGATGGGGAAGTCACAGCCGTGGAGGAGGCACCGGTAAATGCATGTCCCCCTGGATTCAGGCCCTGGGTGACCGAAGAGGCCTATGTCCCAGTGAGTGACATGAACGGCCTGGGATTTAAGCCTTTTGACCTGGTCATTCCGTTTGCTGTCAGGAAAGGAGAAATCACTGGAGAGGTCCACATGCCTTCTGGGAAGACAGCCACACCTGAGATTGTGGACAACAAGGACGGCACGGTCACTGTTAGATATGCCCCCACTGAGGTCGGGCTCCATGAGATGCACATCAAATACATGGGCAGCCACATCCCTGAGAGCCCACTCCAGTTCTACGTGAACTACCCCAACAGTGGAAGTGTTTCTGCATACGGTCCAGGCCTCGTGTATGGAGTGGCCAACAAAACTGCCACCTTCACCATCGTCACAGAGGATGCAGGAGAAGGTGGTCTGGACTTGGCTATTGAGGGCCCCTCAAAAGCAGAAATCAGCTGCATTGACAATAAAGATGGGACATGCACAGTGACCTACCTGCCGACTCTGCCAGGCGACTACAGCATTCTGGTCAAGTACAATGACAAGCACATCCCTGGCAGCCCCTTCACAGCCAAGATCACAGATGACAGCAGGCGGTGCTCCCAGGTGAAGTTGGGCTCAGCCGCTGACTTCCTGCTCGACATCAGTGAGACTGACCTCAGCAGCCTGACGGCCAGCATTAAGGCCCCATCTGGCCGAGACGAGCCCTGTCTCCTGAAGAGGCTGCCCAACAACCACATTGGCATCTCCTTCATCCCCCGGGAAGTGGGCGAACATCTGGTCAGCATCAAGAAAAATGGCAACCATGTGGCCAACAGCCCCGTGTCTATCATGGTGGTCCAGTCGGAGATTGGTGACGCCCGCCGAGCCAAAGTCTATGGCCGCGGCCTGTCAGAAGGCCGGACTTTCGAGATGTCTGACTTCATCGTGGACACAAGGGATGCAGGTTATGGTGGCATATCCTTGGCGGTGGAAGGCCCCAGCAAAGTGGACATCCAGACGGAGGACCTGGAAGATGGCACCTGCAAAGTCTCCTACTTCCCTACCGTGCCTGGGGTTTATATCGTCTCCACCAAATTCGCTGACGAGCACGTGCCTGGGAGCCCATTTACCGTGAAGATCAGTGGGGAGGGAAGAGTCAAAGAGAGCATCACCCGCACCAGTCGGGCCCCGTCCGTGGCCACTGTCGGGAGCATTTGTGACCTGAACCTGAAAATCCCAGAAATCAACAGCAGTGATATGTCGGCCCACGTCACCAGCCCCTCTGGCCGTGTGACTGAGGCAGAGATTGTGCCCATGGGGAAGAACTCACACTGCGTCCGGTTTGTGCCCCAGGAGATGGGCGTGCACACGGTCAGCGTCAAGTACCGTGGGCAGCACGTCACCGGCAGCCCCTTCCAGTTCACCGTGGGGCCACTTGGTGAAGGAGGCGCCCACAAGGTGCGGGCAGGAGGCCCTGGCCTGGAGAGAGGAGAAGCGGGAGTCCCAGCTGAGTTCAGCATTTGGACCCGGGAAGCAGGCGCTGGAGGCCTCTCCATCGCTGTTGAGGGCCCCAGTAAGGCCGAGATTACATTCGATGACCATAAAAATGGGTCGTGCGGTGTATCTTATATTGCCCAAGAGCCTGGTAACTACGAGGTGTCCATCAAGTTCAATGATGAGCACATCCCGGAAAGCCCCTACCTGGTGCCGGTCATCGCACCCTCCGACGACGCCCGCCGCCTCACTGTTATGAGCCTTCAGGAATCGGGATTAAAAGTTAACCAGCCAGCATCCTTTGCTATAAGGTTGAATGGCGCAAAAGGCAAGATTGATGCAAAGGTGCACAGCCCCTCTGGAGCCGTGGAGGAGTGCCACGTGTCTGAGCTGGAGCCAGATAAGTATGCTGTTCGCTTCATCCCTCATGAGAATGGTGTCCACACCATCGATGTCAAGTTCAATGGGAGCCACGTGGTTGGAAGCCCCTTCAAAGTGCGCGTTGGGGAGCCTGGACAAGCGGGGAACCCTGCCCTGGTGTCCGCCTATGGCACGGGACTCGAAGGGGGCACCACAGGTATCCAGTCGGAATTCTTTATTAACACCACCCGAGCAGGTCCAGGGACATTATCCGTCACCATCGAAGGCCCATCCAAGGTTAAAATGGATTGCCAGGAAACACCTGAAGGGTACAAAGTCATGTACACCCCCATGGCTCCTGGTAACTACCTGATCAGCGTCAAATACGGTGGGCCCAACCACATCGTGGGCAGTCCCTTCAAGGCCAAGGTGACAGGCCAGCGTCTAGTTAGCCCTGGCTCAGCCAACGAGACCTCATCCATCCTGGTGGAGTCAGTGACCAGGTCGTCTACAGAGACCTGCTATAGCGCCATTCCCAAGGCATCCTCGGACGCCAGCAAGGTGACCTCTAAGGGGGCAGGGCTCTCAAAGGCCTTTGTGGGCCAGAAGAGTTCCTTCCTGGTGGACTGCAGCAAAGCTGGCTCCAACATGCTGCTGATCGGGGTCCATGGGCCCACCACCCCCTGCGAGGAGGTCTCCATGAAGCATGTAGGCAACCAGCAATACAACGTCACATACGTCGTCAAGGAGAGGGGCGATTATGTGCTGGCTGTGAAGTGGGGGGAGGAACACATCCCTGGCAGCCCTTTTCATGTCACAGTGCCTTAAAACAGTTTTCTCAAATCCTGGAGAGAGTTCTTGTGGTTGCTTTTGTTGCTTGTTTGTAATTCATTTTATACAAAGCCCTCCAGCCTGTTTGTGGGGCTGAAACCCCATCCCTAAAATATTGCTGTTGTAAAATGCCTTCAGAAATAAGTCCTAGACTGGACTCTTGAGGGACATATTGGAGAATCTTAAGAAATGCAAGCTTGTTCAGGGGGCTGAGAAGATCCTGAGTACACTAGGTGCAAACCAGAACTCTTGGTGGAACAGACCAGCCACTGCAGCAGACAGACCAGGAACACAATGAGACTGACATTTCAAAAAAACAAAACTGGCTAGCCTGAGCTGCTGGTTCACTCTTCAGCATTTATGAAACAAGGCTAGGGGAAGATGGGCAGAGAAAAAGGGGACACCTAGTTTGGTTGTCATTTGGCAAAGGAGATGACTTAAAATCCGCTTAATCTCTTCCAGTGTCCGTGTTAATGTATTTGGCTATTAGATCACTAGCACTGCTTTACCGCTCCTCATCGCCAACACCCCCATGCTCTGTGGCCTTCTTACACTTCTCAGAGGGCAGAGTGGCAGCCGGGCACCCTACAGAAACTCAGAGGGCAGAGTGGCAGCCAGGCCCACATGTCTCTCAAGTACCTGTCCCCTCGCTCTGGTGATTATTTCTTGCAGAATCACCACACGAGACCATCCCGGCAGTCATGGTTTTGCTTTAGTTTTCCAAGTCCGTTTCAGTCCCTTCCTTGGTCTGAAGAAATTCTGCAGTGGCGAGCAGTTTCCCACTTGCCAAAGATCCCTTTTAACCAACACTAGCCCTTGTTTTTAACACACGCTCCAGCCCTTCATCAGCCTGGGCAGTCTTACCAAAATGTTTAAAGTGATCTCAGAGGGGCCCATGGATTAACGCCCTCATCCCAAGGTCCGTCCCATGACATAACACTCCACACCCGCCCCAGCCAACTTCATGGGTCACTTTTTCTGGAAAATAATGATCTGTACAGACAGGACAGAATGAAACTCCTGCGGGTCTTTGGCCTGAAAGTTGGGAATGGTTGGGGGAGAGAAGGGCAGCAGCTTATTGGTGGTCTTTTCACCATTGGCAGAAACAGTGAGAGCTGTGTGGTGCAGAAATCCAGAAATGAGGTGTAGGGAATTTTGCCTGCCTTCCTGCAGACCTGAGCTGGCTTTGGAATGAGGTTAAAGTGTCAGGGACGTTGCCTGAGCCCAAATGTGTAGTGTGGTCTGGGCAGGCAGACCTTTAGGTTTTGCTGCTTAGTCCTGAGGAAGTGGCCACTCTTGTGGCAGGTGTAGTATCTGGGGCGAGTGTTGGGGGTAAAAGCCCACCCTACAGAAAGTGGAACAGCCCGGAGCCTGATGTGAAAGGACCACGGGTGTTGTAAGCTGGGACACGGAAGCCAAACTGGAATCAAACGCCGACTGTAAATTGTATCTTATAACTTATTAAATAAAACATTTGCTCCGTAAAGTT