Transcript asmbl_99440

Sequence
Transcript Sequence for observation asmbl_99440 of TGE0059716:
GCGCGGCCAGGGGCGGGCGGCCGCAGAGCAGCACCGGCCGTGGCTCCGGTAGCAGCAAGTTCGAACCCCGCTCCCGCTCCGCTTCGGTTCTCGCTCCTTCGGCCCTTGGGCCTCCAAACACCAGTCCCCGGCAGCTCGTTGCGCATTGCGCTCTCCCCGCCACCAGGATGCCGGTAACCGAGAAGGATCTAGCTGAGGACGCGCCTTGGAAGAAGATCCAGCAGAACACGTTCACACGCTGGTGCAACGAGCACCTCAAGTGCGTGAACAAACGCATCGGCAACCTGCAGACCGACCTGAGCGACGGGCTGCGGCTCATCGCGCTGCTCGAGGTGCTCAGCCAGAAGCGCATGTACCGCAAGTACCATCAGCGGCCCACCTTTCGCCAGATGCAGCTCGAGAATGTGTCCGTGGCGCTCGAGTTCCTGGACCGTGAGAGCATCAAGCTCGTGTCCATCGATAGCAAAGCCATTGTGGATGGGAACCTGAAGCTCATCTTGGGTCTGGTGTGGACGCTGATCCTCCACTACTCCATCTCCATGCCCGTGTGGGAGGATGAAGGGGATGATGATGCCAAGAAGCAGACGCCAAAGCAGAGGCTGCTGGGGTGGATTCAGAACAAGATCCCCTACTTGCCCATCACCAACTTTAACCAGAACTGGCAAGACGGCAAAGCCCTGGGAGCCCTGGTAGACAGCTGTGCTCCAGGTCTGTGCCCAGACTGGGAATCCTGGGACCCGCAGAAGCCTGTGGATAATGCACGAGAAGCCATGCAGCAGGCAGATGACTGGCTGGGTGTCCCACAGGTCATCACTCCTGAAGAAATCATTCACCCGGATGTGGACGAGCACTCAGTTATGACTTACCTGTCCCAGTTCCCCAAAGCCAAGCTCAAGCCGGGGGCTCCTCTCAAACCCAAACTCAACCCGAAGAAAGCCAGGGCCTATGGCAGAGGAATCGAGCCCACTGGAAACATGGTGAAGCAGCCAGCCAAGTTCACTGTGGACACCATCAGCGCCGGGCAAGGAGACGTGATGGTGTTTGTTGAGGACCCAGAAGGGAACAAAGAGGAGGCACAAGTGACCCCTGACAGTGACAAGAACAAGACATACTCTGTGGAGTATCTGCCCAAGGTCACCGGGCTACACAAAGTCACAGTCCTCTTTGCAGGACAGCACATCTCCAAGAGCCCATTTGAAGTGAGTGTTGACAAGGCCCAGGGAGATGCCAGTAAAGTCACTGCAAAAGGTCCAGGGTTGGAAGCTGTAGGGAACATCGCCAATAAGCCCACCTACTTTGACATCTATACGGCAGGAGCTGGTGTGGGTGACATTGGTGTGGAGGTGGAAGATCCCCAGGGGAAGAACACCGTGGAGTTGCTCGTGGAAGACAAAGGAAACCAGGTGTATCGATGTGTGTACAAACCCATGCAGCCTGGCCCTCACGTGGTCAAGATCTTCTTTGCTGGGGACACTATTCCTAAGAGTCCCTTCGTTGTGCAGGTTGGGGAAGCCTGCAATCCAAATGCCTGCCGGGCCAGTGGCCGAGGCCTACAACCCAAAGGCGTCCGTATCCGGGAGACCACAGATTTCAAGGTTGACACCAAAGCTGCAGGAAGTGGGGAGCTCGGTGTAACCATGAAGGGTCCTAAGGGTCTGGAGGAGCTGGTGAAGCAGAAAGACTTTCTGGATGGGGTCTACGCATTCGAGTATTACCCCAGCACCCCGGGGAGATACAGCATTGCCATCACATGGGGGGGACACCACATTCCAAAGAGCCCCTTTGAAGTTCAAGTTGGCCCTGAAGCGGGTATGCAGAAAGTCCGTGCTTGGGGCCCTGGGCTCCATGGTGGGATTGTCGGGCGGTCAGCGGACTTCGTGGTAGAATCCATTGGCTCTGAAGTGGGGTCTCTGGGGTTTGCCATTGAAGGCCCCTCTCAGGCAAAGATTGAGTACAACGACCAGAATGATGGATCGTGTGATGTCAAATACTGGCCCAAGGAGCCTGGCGAATATGCTGTTCACATCATGTGTGACGACGAAGACATCAAGGACAGCCCGTACATGGCCTTCATCCACCCAGCCACGGGAGGCTACAACCCTGATCTGGTTCGAGCATACGGGCCAGGTTTGGAGAAATCTGGATGCATTGTCAACAACCTGGCCGAGTTCACTGTGGATCCTAAGGATGCTGGAAAAGCTCCCTTAAAGATATTTGCTCAGGATGGGGAAGGCCAACGCATTGACATCCAGATGAAGAACCGGATGGACGGCACATATGCATGCTCATACACCCCGGTGAAGGCCATCAAGCACACCATTGCTGTGGTCTGGGGAGGCGTGAACATCCCGCACAGCCCCTACAGGGTCAACATCGGGCAAGGTAGCCATCCTCAGAAGGTCAAAGTGTTTGGGCCAGGTGTGGAGAGAAGTGGTCTGAAGGCAAATGAACCTACACACTTCACGGTGGACTGTACTGAGGCTGGGGAAGGTGATGTCAGTGTTGGCATTAAGTGTGATGCCCGGGTGTTAAGTGAAGATGAGGAAGACGTGGATTTTGACATTATTCACAATGCCAATGATACGTTCACAGTCAAATATGTGCCTCCTGCTGCTGGGCGATACACTATCAAAGTTCTCTTTGCATCTCAGGAAATCCCCGCCAGCCCTTTCAGAGTCAAAGTTGACCCTTCCCACGATGCCAGCAAAGTGAAGGCAGAAGGCCCAGGGCTCAGCAAAGCAGGTGTGGAAAATGGGAAACCGACCCACTTCACTGTCTACACCAAGGGGGCTGGGAAAGCCCCGCTCAACGTGCAGTTCAACAGCCCTCTTCCTGGCGATGCAGTGAAGGATTTGGATATCATCGATAATTATGACTACTCTCACACGGTTAAATATACACCCACCCAACAGGGCAACATGCAGGTTCTGGTGACTTACGGTGGCGATCCCATCCCTAAAAGCCCTTTCACTGTGGGTGTTGCTGCACCGCTGGATCTGAGCAAGATAAAACTCAATGGGCTGGAAAACAGGGTGGAAGTTGGGAAGGATCAGGAGTTCACCGTTGATACCAGGGGGGCAGGAGGCCAGGGGAAGCTGGACGTGACAATCCTCAGCCCCTCTCGGAAGGTCGTGCCATGCCTAGTGACACCTGTGACAGGCCGGGAGAACAGCACGGCCAAGTTCATCCCTCGGGAGGAGGGGCTGTATGCTGTAGACGTGACCTACGATGGACACCCTGTGCCCGGGAGCCCCTACACAGTGGAGGCCTCGCTGCCACCAGATCCCAGCAAGGTGAAGGCCCACGGTCCCGGCCTCGAAGGTGGTCTCGTGGGCAAGCCTGCCGAGTTCACCATCGATACCAAAGGAGCTGGTACTGGAGGTCTGGGCTTAACGGTGGAAGGTCCGTGCGAGGCCAAAATCGAGTGCTCCGACAATGGTGATGGGACCTGCTCCGTCTCTTACCTTCCCACAAAACCCGGGGAGTACTTCGTCAACATCCTCTTTGAAGAAGTCCACATACCTGGGTCTCCCTTCAAAGCTGACATTGAAATGCCCTTTGACCCCTCTAAAGTCGTGGCATCGGGGCCAGGTCTCGAGCACGGGAAGGTGGGTGAAGCTGGCCTCCTTAGCGTCGACTGCTCGGAAGCGGGACCGGGGGCCCTGGGCCTGGAAGCTGTCTCGGACTCGGGAACAAAAGCCGAAGTCAGTATTCAGAACAACAAAGATGGCACCTACGCGGTGACCTACGTGCCCCTGACGGCCGGCATGTACACGTTGACCATGAAGTATGGTGGCGAACTCGTGCCACACTTCCCCGCCCGGGTCAAGGTGGAGCCCGCCGTGGACACCAGCAGGATCAAAGTCTTTGGACCAGGAATAGAAGGGAAAGATGTGTTCCGGGAAGCTACCACCGACTTTACAGTTGACTCTCGGCCGCTGACCCAGGTTGGGGGTGACCACATCAAGGCCCACATTGCCAACCCCTCAGGGGCCTCCACCGAGTGCTTTGTCACAGACAATGCGGATGGGACCTACCAGGTGGAATACACACCCTTTGAGAAAGGTCTCCATGTAGTGGAGGTGACATATGATGACGTGCCTATCCCAAACAGTCCCTTCAAGGTGGCTGTCACTGAAGGCTGCCAGCCATCTAGGGTGCAAGCCCAAGGACCTGGATTGAAAGAGGCCTTTACCAACAAGCCCAATGTCTTCACCGTGGTTACCAGAGGCGCAGGAATTGGTGGGCTTGGCATAACTGTTGAGGGACCATCAGAGTCGAAGATAAATTGCAGAGACAACAAGGATGGCAGCTGCAGTGCTGAGTACATTCCTTTCGCACCGGGGGATTACGATGTTAATATCACATATGGAGGAGCCCACATCCCCGGCAGCCCCTTCAGGGTTCCTGTGAAGGATGTTGTGGACCCCAGCAAGGTCAAGATTGCCGGCCCCGGGCTGGGCTCAGGCGTCCGAGCCCGTGTCCTGCAGTCCTTCACGGTGGACAGCAGCAAGGCTGGCCTGGCTCCGCTGGAAGTGAGGGTTCTGGGCCCACGAGGCTTGGTGGAGCCAGTGAACGTGGTGGACAATGGAGATGGCACACACACAGTAACCTACACCCCATCTCAGGAGGGACCTTACATGGTCTCAGTTAAATATGCTGATGAAGAGATTCCTCGCAGTCCCTTCAAGGTCAAGGTCCTTCCCACATATGATGCCAGCAAAGTGACTGCCAGTGGCCCCGGCCTTAGTTCCTATGGTGTGCCTGCCAGTCTACCTGTGGACTTTGCAATTGATGCCCGAGATGCCGGGGAAGGCCTGCTTGCTGTTCAAATAACGGACCAAGAAGGAAAACCCAAAAGAGCCATTGTCCATGACAATAAAGATGGCACGTATGCTGTCACCTACATCCCCGACAAGACTGGGCGCTATATGATTGGAGTCACCTACGGGGGTGACGACATCCCACTTTCTCCTTATCGCATCCGAGCCACACAGACGGGTGATGCCAGCAAGTGCCTGGCCACGGGTCCTGGAATCGCCTCCACTGTGAAAACTGGCGAAGAAGTAGGCTTTGTGGTTGATGCCAAGACTGCCGGGAAGGGTAAAGTGACCTGCACGGTTCTGACCCCAGATGGCACTGAGGCCGAGGCCGATGTCATTGAGAATGAAGATGGAACCTATGACATCTTCTACACAGCTGCCAAGCCGGGCACATATGTGATCTATGTGCGCTTCGGTGGTGTTGATATTCCTAACAGCCCCTTCACTGTCATGGTGACCGAAGAGGCCTATGTCCCAGTGAGTGACATGAACGGCCTGGGATTTAAGCCTTTTGACCTGGTCATTCCGTTTGCTGTCAGGAAAGGAGAAATCACTGGAGAGGTCCACATGCCTTCTGGGAAGACAGCCACACCTGAGATTGTGGACAACAAGGACGGCACGGTCACTGTTAGATATGCCCCCACTGAGGTCGGGCTCCATGAGATGCACATCAAATACATGGGCAGCCACATCCCTGAGAGCCCACTCCAGTTCTACGTGAACTACCCCAACAGTGGAAGTGTTTCTGCATACGGTCCAGGCCTCGTGTATGGAGTGGCCAACAAAACTGCCACCTTCACCATCGTCACAGAGGATGCAGGAGAAGGTGGTCTGGACTTGGCTATTGAGGGCCCCTCAAAAGCAGAAATCAGCTGCATTGACAATAAAGATGGGACATGCACAGTGACCTACCTGCCGACTCTGCCAGGCGACTACAGCATTCTGGTCAAGTACAATGACAAGCACATCCCTGGCAGCCCCTTCACAGCCAAGATCACAGATGACAGCAGGCGGTGCTCCCAGGTGAAGTTGGGCTCAGCCGCTGACTTCCTGCTCGACATCAGTGAGACTGACCTCAGCAGCCTGACGGCCAGCATTAAGGCCCCATCTGGCCGAGACGAGCCCTGTCTCCTGAAGAGGCTGCCCAACAACCACATTGGCATCTCCTTCATCCCCCGGGAAGTGGGCGAACATCTGGTCAGCATCAAGAAAAATGGCAACCATGTGGCCAACAGCCCCGTGTCTATCATGGTGGTCCAGTCGGAGATTGGTGACGCCCGCCGAGCCAAAGTCTATGGCCGCGGCCTGTCAGAAGGCCGGACTTTCGAGATGTCTGACTTCATCGTGGACACAAGGGATGCAGGTTATGGTGGCATATCCTTGGCGGTGGAAGGCCCCAGCAAAGTGGACATCCAGACGGAGGACCTGGAAGATGGCACCTGCAAAGTCTCCTACTTCCCTACCGTGCCTGGGGTTTATATCGTCTCCACCAAATTCGCTGACGAGCACGTGCCTGGGAGCCCATTTACCGTGAAGATCAGTGGGGAGGGAAGAGTCAAAGAGAGCATCACCCGCACCAGTCGGGCCCCGTCCGTGGCCACTGTCGGGAGCATTTGTGACCTGAACCTGAAAATCCCAGAAATCAACAGCAGTGATATGTCGGCCCACGTCACCAGCCCCTCTGGCCGTGTGACTGAGGCAGAGATTGTGCCCATGGGGAAGAACTCACACTGCGTCCGGTTTGTGCCCCAGGAGATGGGCGTGCACACGGTCAGCGTCAAGTACCGTGGGCAGCACGTCACCGGCAGCCCCTTCCAGTTCACCGTGGGGCCACTTGGTGAAGGAGGCGCCCACAAGGTGCGGGCAGGAGGCCCTGGCCTGGAGAGAGGAGAAGCGGGAGTCCCAGCTGAGTTCAGCATTTGGACCCGGGAAGCAGGCGCTGGAGGCCTCTCCATCGCTGTTGAGGGCCCCAGTAAGGCCGAGATTACATTCGATGACCATAAAAATGGGTCGTGCGGTGTATCTTATATTGCCCAAGAGCCTGGTAACTACGAGGTGTCCATCAAGTTCAATGATGAGCACATCCCGGAAAGCCCCTACCTGGTGCCGGTCATCGCACCCTCCGACGACGCCCGCCGCCTCACTGTTATGAGCCTTCAGGAATCGGGATTAAAAGTTAACCAGCCAGCATCCTTTGCTATAAGGTTGAATGGCGCAAAAGGCAAGATTGATGCAAAGGTGCACAGCCCCTCTGGAGCCGTGGAGGAGTGCCACGTGTCTGAGCTGGAGCCAGATAAGTATGCTGTTCGCTTCATCCCTCATGAGAATGGTGTCCACACCATCGATGTCAAGTTCAATGGGAGCCACGTGGTTGGAAGCCCCTTCAAAGTGCGCGTTGGGGAGCCTGGACAAGCGGGGAACCCTGCCCTGGTGTCCGCCTATGGCACGGGACTCGAAGGGGGCACCACAGGTATCCAGTCGGAATTCTTTATTAACACCACCCGAGCAGGTCCAGGGACATTATCCGTCACCATCGAAGGCCCATCCAAGGTTAAAATGGATTGCCAGGAAACACCTGAAGGGTACAAAGTCATGTACACCCCCATGGCTCCTGGTAACTACCTGATCAGCGTCAAATACGGTGGGCCCAACCACATCGTGGGCAGTCCCTTCAAGGCCAAGGTGACAGGCCAGCGTCTAGTTAGCCCTGGCTCAGCCAACGAGACCTCATCCATCCTGGTGGAGTCAGTGACCAGGTCGTCTACAGAGACCTGCTATAGCGCCATTCCCAAGGCATCCTCGGACGCCAGCAAGGTGACCTCTAAGGGGGCAGGGCTCTCAAAGGCCTTTGTGGGCCAGAAGAGTTCCTTCCTGGTGGACTGCAGCAAAGCTGGCTCCAACATGCTGCTGATCGGGGTCCATGGGCCCACCACCCCCTGCGAGGAGGTCTCCATGAAGCATGTAGGCAACCAGCAATACAACGTCACATACGTCGTCAAGGAGAGGGGCGATTATGTGCTGGCTGTGAAGTGGGGGGAGGAACACATCCCTGGCAGCCCTTTTCATGTCACAGTGCCTTAAAACAGTTTTCTCAAATCCTGGAGAGAGTTCTTGTGGTTGCTTTTGTTGCTTGTTTGTAATTCATTTTATACAAAGCCCTCCAGCCTGTTTGTGGGGCTGAAACCCCATCCCTAAAATATTGCTGTTGTAAAATGCCTTCAGAAATAAGTCCTAGACTGGACTCTTGAGGGACATATTGGAGAATCTTAAGAAATGCAAGCTTGTTCAGGGGGCTGAGAAGATCCTGAGTACACTAGGTGCAAACCAGAACTCTTGGTGGAACAGACCAGCCACTGCAGCAGACAGACCAGGAACACAATGAGACTGACATTTCAAAAAAACAAAACTGGCTAGCCTGAGCTGCTGGTTCACTCTTCAGCATTTATGAAACAAGGCTAGGGGAAGATGGGCAGAGAAAAAGGGGACACCTAGTTTGGTTGTCATTTGGCAAAGGAGATGACTTAAAATCCGCTTAATCTCTTCCAGTGTCCGTGTTAATGTATTTGGCTATTAGATCACTAGCACTGCTTTACCGCTCCTCATCGCCAACACCCCCATGCTCTGTGGCCTTCTTACACTTCTCAGAGGGCAGAGTGGCAGCCGGGCACCCTACAGAAACTCAGAGGGCAGAGTGGCAGCCAGGCCCACATGTCTCTCAAGTACCTGTCCCCTCGCTCTGGTGATTATTTCTTGCAGAATCACCACACGAGACCATCCCGGCAGTCATGGTTTTGCTTTAGTTTTCCAAGTCCGTTTCAGTCCCTTCCTTGGTCTGAAGAAATTCTGCAGTGGCGAGCAGTTTCCCACTTGCCAAAGATCCCTTTTAACCAACACTAGCCCTTGTTTTTAACACACGCTCCAGCCCTTCATCAGCCTGGGCAGTCTTACCAAAATGTTTAAAGTGATCTCAGAGGGGCCCATGGATTAACGCCCTCATCCCAAGGTCCGTCCCATGACATAACACTCCACACCCGCCCCAGCCAACTTCATGGGTCACTTTTTCTGGAAAATAATGATCTGTACAGACAGGACAGAATGAAACTCCTGCGGGTCTTTGGCCTGAAAGTTGGGAATGGTTGGGGGAGAGAAGGGCAGCAGCTTATTGGTGGTCTTTTCACCATTGGCAGAAACAGTGAGAGCTGTGTGGTGCAGAAATCCAGAAATGAGGTGTAGGGAATTTTGCCTGCCTTCCTGCAGACCTGAGCTGGCTTTGGAATGAGGTTAAAGTGTCAGGGACGTTGCCTGAGCCCAAATGTGTAGTGTGGTCTGGGCAGGCAGACCTTTAGGTTTTGCTGCTTAGTCCTGAGGAAGTGGCCACTCTTGTGGCAGGTGTAGTATCTGGGGCGAGTGTTGGGGGTAAAAGCCCACCCTACAGAAAGTGGAACAGCCCGGAGCCTGATGTGAAAGGACCACGGGTGTTGTAAGCTGGGACACGGAAGCCAAACTGGAATCAAACGCCGACTGTAAATTGTATCTTATAACTTATTAAATAAAACATTTGCTCCGTAAAGTT