Transcript asmbl_99439

Sequence
Transcript Sequence for observation asmbl_99439 of TGE0059715:
GCGCGGCCAGGGGCGGGCGGCCGCAGAGCAGCACCGGCCGTGGCTCCGGTAGCAGCAAGTTCGAACCCCGCTCCCGCTCCGCTTCGGTTCTCGCTCCTTCGGCCCTTGGGCCTCCAAACACCAGTCCCCGGCAGCTCGTTGCGCATTGCGCTCTCCCCGCCACCAGGATGCCGGTAACCGAGAAGGATCTAGCTGAGGACGCGCCTTGGAAGAAGATCCAGCAGAACACGTTCACACGCTGGTGCAACGAGCACCTCAAGTGCGTGAACAAACGCATCGGCAACCTGCAGACCGACCTGAGCGACGGGCTGCGGCTCATCGCGCTGCTCGAGGTGCTCAGCCAGAAGCGCATGTACCGCAAGTACCATCAGCGGCCCACCTTTCGCCAGATGCAGCTCGAGAATGTGTCCGTGGCGCTCGAGTTCCTGGACCGTGAGAGCATCAAGCTCGTGTCCATCGATAGCAAAGCCATTGTGGATGGGAACCTGAAGCTCATCTTGGGTCTGGTGTGGACGCTGATCCTCCACTACTCCATCTCCATGCCCGTGTGGGAGGATGAAGGGGATGATGATGCCAAGAAGCAGACGCCAAAGCAGAGGCTGCTGGGGTGGATTCAGAACAAGATCCCCTACTTGCCCATCACCAACTTTAACCAGAACTGGCAAGACGGCAAAGCCCTGGGAGCCCTGGTAGACAGCTGTGCTCCAGGTCTGTGCCCAGACTGGGAATCCTGGGACCCGCAGAAGCCTGTGGATAATGCACGAGAAGCCATGCAGCAGGCAGATGACTGGCTGGGTGTCCCACAGGTCATCACTCCTGAAGAAATCATTCACCCGGATGTGGACGAGCACTCAGTTATGACTTACCTGTCCCAGTTCCCCAAAGCCAAGCTCAAGCCGGGGGCTCCTCTCAAACCCAAACTCAACCCGAAGAAAGCCAGGGCCTATGGCAGAGGAATCGAGCCCACTGGAAACATGGTGAAGCAGCCAGCCAAGTTCACTGTGGACACCATCAGCGCCGGGCAAGGAGACGTGATGGTGTTTGTTGAGGACCCAGAAGGGAACAAAGAGGAGGCACAAGTGACCCCTGACAGTGACAAGAACAAGACATACTCTGTGGAGTATCTGCCCAAGGTCACCGGGCTACACAAAGTCACAGTCCTCTTTGCAGGACAGCACATCTCCAAGAGCCCATTTGAAGTGAGTGTTGACAAGGCCCAGGGAGATGCCAGTAAAGTCACTGCAAAAGGTCCAGGGTTGGAAGCTGTAGGGAACATCGCCAATAAGCCCACCTACTTTGACATCTATACGGCAGGAGCTGGTGTGGGTGACATTGGTGTGGAGGTGGAAGATCCCCAGGGGAAGAACACCGTGGAGTTGCTCGTGGAAGACAAAGGAAACCAGGTGTATCGATGTGTGTACAAACCCATGCAGCCTGGCCCTCACGTGGTCAAGATCTTCTTTGCTGGGGACACTATTCCTAAGAGTCCCTTCGTTGTGCAGGTTGGGGAAGCCTGCAATCCAAATGCCTGCCGGGCCAGTGGCCGAGGCCTACAACCCAAAGGCGTCCGTATCCGGGAGACCACAGATTTCAAGGTTGACACCAAAGCTGCAGGAAGTGGGGAGCTCGGTGTAACCATGAAGGGTCCTAAGGGTCTGGAGGAGCTGGTGAAGCAGAAAGACTTTCTGGATGGGGTCTACGCATTCGAGTATTACCCCAGCACCCCGGGGAGATACAGCATTGCCATCACATGGGGGGGACACCACATTCCAAAGAGCCCCTTTGAAGTTCAAGTTGGCCCTGAAGCGGGTATGCAGAAAGTCCGTGCTTGGGGCCCTGGGCTCCATGGTGGGATTGTCGGGCGGTCAGCGGACTTCGTGGTAGAATCCATTGGCTCTGAAGTGGGGTCTCTGGGGTTTGCCATTGAAGGCCCCTCTCAGGCAAAGATTGAGTACAACGACCAGAATGATGGATCGTGTGATGTCAAATACTGGCCCAAGGAGCCTGGCGAATATGCTGTTCACATCATGTGTGACGACGAAGACATCAAGGACAGCCCGTACATGGCCTTCATCCACCCAGCCACGGGAGGCTACAACCCTGATCTGGTTCGAGCATACGGGCCAGGTTTGGAGAAATCTGGATGCATTGTCAACAACCTGGCCGAGTTCACTGTGGATCCTAAGGATGCTGGAAAAGCTCCCTTAAAGATATTTGCTCAGGATGGGGAAGGCCAACGCATTGACATCCAGATGAAGAACCGGATGGACGGCACATATGCATGCTCATACACCCCGGTGAAGGCCATCAAGCACACCATTGCTGTGGTCTGGGGAGGCGTGAACATCCCGCACAGCCCCTACAGGGTCAACATCGGGCAAGGTAGCCATCCTCAGAAGGTCAAAGTGTTTGGGCCAGGTGTGGAGAGAAGTGGTCTGAAGGCAAATGAACCTACACACTTCACGGTGGACTGTACTGAGGCTGGGGAAGGTGATGTCAGTGTTGGCATTAAGTGTGATGCCCGGGTGTTAAGTGAAGATGAGGAAGACGTGGATTTTGACATTATTCACAATGCCAATGATACGTTCACAGTCAAATATGTGCCTCCTGCTGCTGGGCGATACACTATCAAAGTTCTCTTTGCATCTCAGGAAATCCCCGCCAGCCCTTTCAGAGTCAAAGTTGACCCTTCCCACGATGCCAGCAAAGTGAAGGCAGAAGGCCCAGGGCTCAGCAAAGCAGGTGTGGAAAATGGGAAACCGACCCACTTCACTGTCTACACCAAGGGGGCTGGGAAAGCCCCGCTCAACGTGCAGTTCAACAGCCCTCTTCCTGGCGATGCAGTGAAGGATTTGGATATCATCGATAATTATGACTACTCTCACACGGTTAAATATACACCCACCCAACAGGGCAACATGCAGGTTCTGGTGACTTACGGTGGCGATCCCATCCCTAAAAGCCCTTTCACTGTGGGTGTTGCTGCACCGCTGGATCTGAGCAAGATAAAACTCAATGGGCTGGAAAACAGGGTGGAAGTTGGGAAGGATCAGGAGTTCACCGTTGATACCAGGGGGGCAGGAGGCCAGGGGAAGCTGGACGTGACAATCCTCAGCCCCTCTCGGAAGGTCGTGCCATGCCTAGTGACACCTGTGACAGGCCGGGAGAACAGCACGGCCAAGTTCATCCCTCGGGAGGAGGGGCTGTATGCTGTAGACGTGACCTACGATGGACACCCTGTGCCCGGGAGCCCCTACACAGTGGAGGCCTCGCTGCCACCAGATCCCAGCAAGGTGAAGGCCCACGGTCCCGGCCTCGAAGGTGGTCTCGTGGGCAAGCCTGCCGAGTTCACCATCGATACCAAAGGAGCTGGTACTGGAGGTCTGGGCTTAACGGTGGAAGGTCCGTGCGAGGCCAAAATCGAGTGCTCCGACAATGGTGATGGGACCTGCTCCGTCTCTTACCTTCCCACAAAACCCGGGGAGTACTTCGTCAACATCCTCTTTGAAGAAGTCCACATACCTGGGTCTCCCTTCAAAGCTGACATTGAAATGCCCTTTGACCCCTCTAAAGTCGTGGCATCGGGGCCAGGTCTCGAGCACGGGAAGGTGGGTGAAGCTGGCCTCCTTAGCGTCGACTGCTCGGAAGCGGGACCGGGGGCCCTGGGCCTGGAAGCTGTCTCGGACTCGGGAACAAAAGCCGAAGTCAGTATTCAGAACAACAAAGATGGCACCTACGCGGTGACCTACGTGCCCCTGACGGCCGGCATGTACACGTTGACCATGAAGTATGGTGGCGAACTCGTGCCACACTTCCCCGCCCGGGTCAAGGTGGAGCCCGCCGTGGACACCAGCAGGATCAAAGTCTTTGGACCAGGAATAGAAGGGAAAGATGTGTTCCGGGAAGCTACCACCGACTTTACAGTTGACTCTCGGCCGCTGACCCAGGTTGGGGGTGACCACATCAAGGCCCACATTGCCAACCCCTCAGGGGCCTCCACCGAGTGCTTTGTCACAGACAATGCGGATGGGACCTACCAGGTGGAATACACACCCTTTGAGAAAGGTCTCCATGTAGTGGAGGTGACATATGATGACGTGCCTATCCCAAACAGTCCCTTCAAGGTGGCTGTCACTGAAGGCTGCCAGCCATCTAGGGTGCAAGCCCAAGGACCTGGATTGAAAGAGGCCTTTACCAACAAGCCCAATGTCTTCACCGTGGTTACCAGAGGCGCAGGAATTGGTGGGCTTGGCATAACTGTTGAGGGACCATCAGAGTCGAAGATAAATTGCAGAGACAACAAGGATGGCAGCTGCAGTGCTGAGTACATTCCTTTCGCACCGGGGGATTACGATGTTAATATCACATATGGAGGAGCCCACATCCCCGGCAGCCCCTTCAGGGTTCCTGTGAAGGATGTTGTGGACCCCAGCAAGGTCAAGATTGCCGGCCCCGGGCTGGGCTCAGGCGTCCGAGCCCGTGTCCTGCAGTCCTTCACGGTGGACAGCAGCAAGGCTGGCCTGGCTCCGCTGGAAGTGAGGGTTCTGGGCCCACGAGGCTTGGTGGAGCCAGTGAACGTGGTGGACAATGGAGATGGCACACACACAGTAACCTACACCCCATCTCAGGAGGGACCTTACATGGTCTCAGTTAAATATGCTGATGAAGAGATTCCTCGCAGTCCCTTCAAGGTCAAGGTCCTTCCCACATATGATGCCAGCAAAGTGACTGCCAGTGGCCCCGGCCTTAGTTCCTATGGTGTGCCTGCCAGTCTACCTGTGGACTTTGCAATTGATGCCCGAGATGCCGGGGAAGGCCTGCTTGCTGTTCAAATAACGGACCAAGAAGGAAAACCCAAAAGAGCCATTGTCCATGACAATAAAGATGGCACGTATGCTGTCACCTACATCCCCGACAAGACTGGGCGCTATATGATTGGAGTCACCTACGGGGGTGACGACATCCCACTTTCTCCTTATCGCATCCGAGCCACACAGACGGGTGATGCCAGCAAGTGCCTGGCCACGGGTCCTGGAATCGCCTCCACTGTGAAAACTGGCGAAGAAGTAGGCTTTGTGGTTGATGCCAAGACTGCCGGGAAGGGTAAAGTGACCTGCACGGTTCTGACCCCAGATGGCACTGAGGCCGAGGCCGATGTCATTGAGAATGAAGATGGAACCTATGACATCTTCTACACAGCTGCCAAGCCGGGCACATATGTGATCTATGTGCGCTTCGGTGGTGTTGATATTCCTAACAGCCCCTTCACTGTCATGGCCACAGATGGGGAAGTCACAGCCGTGGAGGAGGCACCGGTGACCGAAGAGGCCTATGTCCCAGTGAGTGACATGAACGGCCTGGGATTTAAGCCTTTTGACCTGGTCATTCCGTTTGCTGTCAGGAAAGGAGAAATCACTGGAGAGGTCCACATGCCTTCTGGGAAGACAGCCACACCTGAGATTGTGGACAACAAGGACGGCACGGTCACTGTTAGATATGCCCCCACTGAGGTCGGGCTCCATGAGATGCACATCAAATACATGGGCAGCCACATCCCTGAGAGCCCACTCCAGTTCTACGTGAACTACCCCAACAGTGGAAGTGTTTCTGCATACGGTCCAGGCCTCGTGTATGGAGTGGCCAACAAAACTGCCACCTTCACCATCGTCACAGAGGATGCAGGAGAAGGTGGTCTGGACTTGGCTATTGAGGGCCCCTCAAAAGCAGAAATCAGCTGCATTGACAATAAAGATGGGACATGCACAGTGACCTACCTGCCGACTCTGCCAGGCGACTACAGCATTCTGGTCAAGTACAATGACAAGCACATCCCTGGCAGCCCCTTCACAGCCAAGATCACAGATGACAGCAGGCGGTGCTCCCAGGTGAAGTTGGGCTCAGCCGCTGACTTCCTGCTCGACATCAGTGAGACTGACCTCAGCAGCCTGACGGCCAGCATTAAGGCCCCATCTGGCCGAGACGAGCCCTGTCTCCTGAAGAGGCTGCCCAACAACCACATTGGCATCTCCTTCATCCCCCGGGAAGTGGGCGAACATCTGGTCAGCATCAAGAAAAATGGCAACCATGTGGCCAACAGCCCCGTGTCTATCATGGTGGTCCAGTCGGAGATTGGTGACGCCCGCCGAGCCAAAGTCTATGGCCGCGGCCTGTCAGAAGGCCGGACTTTCGAGATGTCTGACTTCATCGTGGACACAAGGGATGCAGGTTATGGTGGCATATCCTTGGCGGTGGAAGGCCCCAGCAAAGTGGACATCCAGACGGAGGACCTGGAAGATGGCACCTGCAAAGTCTCCTACTTCCCTACCGTGCCTGGGGTTTATATCGTCTCCACCAAATTCGCTGACGAGCACGTGCCTGGGAGCCCATTTACCGTGAAGATCAGTGGGGAGGGAAGAGTCAAAGAGAGCATCACCCGCACCAGTCGGGCCCCGTCCGTGGCCACTGTCGGGAGCATTTGTGACCTGAACCTGAAAATCCCAGAAATCAACAGCAGTGATATGTCGGCCCACGTCACCAGCCCCTCTGGCCGTGTGACTGAGGCAGAGATTGTGCCCATGGGGAAGAACTCACACTGCGTCCGGTTTGTGCCCCAGGAGATGGGCGTGCACACGGTCAGCGTCAAGTACCGTGGGCAGCACGTCACCGGCAGCCCCTTCCAGTTCACCGTGGGGCCACTTGGTGAAGGAGGCGCCCACAAGGTGCGGGCAGGAGGCCCTGGCCTGGAGAGAGGAGAAGCGGGAGTCCCAGCTGAGTTCAGCATTTGGACCCGGGAAGCAGGCGCTGGAGGCCTCTCCATCGCTGTTGAGGGCCCCAGTAAGGCCGAGATTACATTCGATGACCATAAAAATGGGTCGTGCGGTGTATCTTATATTGCCCAAGAGCCTGGTAACTACGAGGTGTCCATCAAGTTCAATGATGAGCACATCCCGGAAAGCCCCTACCTGGTGCCGGTCATCGCACCCTCCGACGACGCCCGCCGCCTCACTGTTATGAGCCTTCAGGAATCGGGATTAAAAGTTAACCAGCCAGCATCCTTTGCTATAAGGTTGAATGGCGCAAAAGGCAAGATTGATGCAAAGGTGCACAGCCCCTCTGGAGCCGTGGAGGAGTGCCACGTGTCTGAGCTGGAGCCAGATAAGTATGCTGTTCGCTTCATCCCTCATGAGAATGGTGTCCACACCATCGATGTCAAGTTCAATGGGAGCCACGTGGTTGGAAGCCCCTTCAAAGTGCGCGTTGGGGAGCCTGGACAAGCGGGGAACCCTGCCCTGGTGTCCGCCTATGGCACGGGACTCGAAGGGGGCACCACAGGTATCCAGTCGGAATTCTTTATTAACACCACCCGAGCAGGTCCAGGGACATTATCCGTCACCATCGAAGGCCCATCCAAGGTTAAAATGGATTGCCAGGAAACACCTGAAGGGTACAAAGTCATGTACACCCCCATGGCTCCTGGTAACTACCTGATCAGCGTCAAATACGGTGGGCCCAACCACATCGTGGGCAGTCCCTTCAAGGCCAAGGTGACAGGCCAGCGTCTAGTTAGCCCTGGCTCAGCCAACGAGACCTCATCCATCCTGGTGGAGTCAGTGACCAGGTCGTCTACAGAGACCTGCTATAGCGCCATTCCCAAGGCATCCTCGGACGCCAGCAAGGTGACCTCTAAGGGGGCAGGGCTCTCAAAGGCCTTTGTGGGCCAGAAGAGTTCCTTCCTGGTGGACTGCAGCAAAGCTGGCTCCAACATGCTGCTGATCGGGGTCCATGGGCCCACCACCCCCTGCGAGGAGGTCTCCATGAAGCATGTAGGCAACCAGCAATACAACGTCACATACGTCGTCAAGGAGAGGGGCGATTATGTGCTGGCTGTGAAGTGGGGGGAGGAACACATCCCTGGCAGCCCTTTTCATGTCACAGTGCCTTAAAACAGTTTTCTCAAATCCTGGAGAGAGTTCTTGTGGTTGCTTTTGTTGCTTGTTTGTAATTCATTTTATACAAAGCCCTCCAGCCTGTTTGTGGGGCTGAAACCCCATCCCTAAAATATTGCTGTTGTAAAATGCCTTCAGAAATAAGTCCTAGACTGGACTCTTGAGGGACATATTGGAGAATCTTAAGAAATGCAAGCTTGTTCAGGGGGCTGAGAAGATCCTGAGTACACTAGGTGCAAACCAGAACTCTTGGTGGAACAGACCAGCCACTGCAGCAGACAGACCAGGAACACAATGAGACTGACATTTCAAAAAAACAAAACTGGCTAGCCTGAGCTGCTGGTTCACTCTTCAGCATTTATGAAACAAGGCTAGGGGAAGATGGGCAGAGAAAAAGGGGACACCTAGTTTGGTTGTCATTTGGCAAAGGAGATGACTTAAAATCCGCTTAATCTCTTCCAGTGTCCGTGTTAATGTATTTGGCTATTAGATCACTAGCACTGCTTTACCGCTCCTCATCGCCAACACCCCCATGCTCTGTGGCCTTCTTACACTTCTCAGAGGGCAGAGTGGCAGCCGGGCACCCTACAGAAACTCAGAGGGCAGAGTGGCAGCCAGGCCCACATGTCTCTCAAGTACCTGTCCCCTCGCTCTGGTGATTATTTCTTGCAGAATCACCACACGAGACCATCCCGGCAGTCATGGTTTTGCTTTAGTTTTCCAAGTCCGTTTCAGTCCCTTCCTTGGTCTGAAGAAATTCTGCAGTGGCGAGCAGTTTCCCACTTGCCAAAGATCCCTTTTAACCAACACTAGCCCTTGTTTTTAACACACGCTCCAGCCCTTCATCAGCCTGGGCAGTCTTACCAAAATGTTTAAAGTGATCTCAGAGGGGCCCATGGATTAACGCCCTCATCCCAAGGTCCGTCCCATGACATAACACTCCACACCCGCCCCAGCCAACTTCATGGGTCACTTTTTCTGGAAAATAATGATCTGTACAGACAGGACAGAATGAAACTCCTGCGGGTCTTTGGCCTGAAAGTTGGGAATGGTTGGGGGAGAGAAGGGCAGCAGCTTATTGGTGGTCTTTTCACCATTGGCAGAAACAGTGAGAGCTGTGTGGTGCAGAAATCCAGAAATGAGGTGTAGGGAATTTTGCCTGCCTTCCTGCAGACCTGAGCTGGCTTTGGAATGAGGTTAAAGTGTCAGGGACGTTGCCTGAGCCCAAATGTGTAGTGTGGTCTGGGCAGGCAGACCTTTAGGTTTTGCTGCTTAGTCCTGAGGAAGTGGCCACTCTTGTGGCAGGTGTAGTATCTGGGGCGAGTGTTGGGGGTAAAAGCCCACCCTACAGAAAGTGGAACAGCCCGGAGCCTGATGTGAAAGGACCACGGGTGTTGTAAGCTGGGACACGGAAGCCAAACTGGAATCAAACGCCGACTGTAAATTGTATCTTATAACTTATTAAATAAAACATTTGCTCCGTAAAGTT