Transcript asmbl_98436

Sequence
Transcript Sequence for observation asmbl_98436 of TGE0001771:
ATCGGCTCCCGGAAGTTCCACGTCAGTCAGTCTGACGGTCAGTGGATCGGTGGGTTTATCTCAAGGCCTGAGTAGCCGGTAACAAACGAGGGTTCCCGGGATTGGACCGACGCAGCCATGCCTCTGCGACTTGATATCAAAAGAAAGCTAACTGCTAGATCTGATCGAGTTAAGAGTGTGGATCTGCATCCTACAGAGCCATGGATGTTGGCAAGTCTTTACAATGGCAGTGTGTGTGTTTGGAATCATGAAACACAGACACTGGTGAAGACATTTGAAGTATGTGATCTTCCTGTTCGAGCTGCAAAGTTTGTTGCAAGGAAGAATTGGGTTGTGACAGGAGCGGATGACATGCAGATTAGAGTGTTCAATTACAATACTCTGGAGAGAGTTCATATGTTTGAAGCACACTCAGACTACATTCGCTGTATTGCTGTTCATCCAACCCAGCCTTTCATTCTAACTAGCAGTGATGACATGCTTATTAAGCTCTGGGACTGGGATAAAAAATGGTCTTGCTCACAAGTGTTTGAAGGACACACCCATTATGTTATGCAGATTGTGATCAACCCCAAAGATAACAATCAGTTTGCCAGTGCCTCTTTGGACAGGACTATCAAGGTGTGGCAGTTGGGCTCTTCGTCACCAAACTTCACTTTGGAAGGACATGAGAAAGGCGTGAATTGCATTGATTACTACAGTGGTGGGGACAAGCCATACCTCATTTCAGGTGCAGATGACCGTCTTGTTAAAATATGGGATTATCAGAATAAAACATGTGTGCAGACACTGGAAGGACATGCCCAAAATGTGTCTTGTGCCAGCTTTCATCCTGAGTTGCCAATCATTATCACAGGTTCAGAAGATGGAACAGTACGTATTTGGCATTCAAGCACCTACCGGCTTGAGAGCACACTGAATTATGGAATGGAGAGGGTATGGTGCGTGGCCAGTCTAAGAGGGTCAAACAATGTCGCTTTGGGCTATGATGAAGGGAGCATCATTGTTAAGCTTGGTCGGGAGGAACCTGCCATGTCCATGGATGCCAATGGAAAGATAATTTGGGCCAAGCATTCAGAAGTCCAGCAGGCCAACCTAAAAGCAATGGGAGATGCTGAAATTAAAGATGGTGAAAGATTGCCACTGGCAGTAAAGGATATGGGCAGTTGTGAAATATACCCTCAGACTATTCAGCACAATCCTAATGGGCGGTTTGTGGTGGTGTGTGGTGATGGGGAGTATATCATCTACACAGCAATGGCATTGAGAAACAAGAGCTTTGGATCTGCTCAGGAGTTTGCATGGGCCCACGATTCTTCAGAGTATGCAATAAGAGAGAGCAACAGCATTGTAAAGATATTTAAGAACTTTAAGGAAAAAAAATCATTTAAACCAGATTTTGGAGCAGAAAGTATCTACGGCGGCTTCTTATTGGGAGTCAGATCTGTAAATGGCTTAGCCTTCTATGACTGGGACAATACAGAACTCATACGAAGAATTGAAATTCAGCCCAAACATATTTTCTGGTCTGACTCTGGAGAGCTAGTCTGTATTGCTACTGAGGAATCATTTTTTATCCTTAAGTATCTGTCAGAAAAAGTCTTGGCTGCACAGGAAACACATGAGGGAGTTACTGAAGATGGCATTGAAGATGCCTTTGAGGTTCTTGGTGAGATTCAGGAAATTGTGAAAACAGGGCTTTGGGTAGGCGATTGCTTCATTTACACAAGTTCTGTGAACAGATTAAATTATTATGTTGGAGGAGAAATAGTCACCATTGCCCACTTGGACAGGACGATGTATCTCCTAGGCTACATTCCTAAAGACAACAGGCTTTATCTGGGGGATAAAGAATTGAACATCATTAGCTATTCCCTGCTGGTTTCAGTCCTGGAATACCAGACAGCTGTCATGCGGAGGGACTTTAGCATGGCTGATAAGGTCCTTCCTACCATTCCAAAAGAACAGAGGACCAGAGTTGCACACTTTTTGGAAAAGCAGGGCTTCAAGCAGCAAGCTCTTACAGTATCCACAGATCCTGAGCATCGTTTTGAGCTTGCTCTTCAGCTTGGAGAGTTAAAAATTGCATACCAGTTAGCAGTGGAAGCAGAGTCAGAACAGAAGTGGAAACAACTTGCTGAACTTGCCATTAGTAAATGTCAGTTTGGCCTAGCCCAGGAGTGCCTGCATCATGCACAGGATTATGGGGGCCTGCTGCTTTTGGCCACTGCCTCTGGAAATGCTAATATGGTGAACAAGCTAGCAGAGGGTGCGGAGAGAGATGGCAAAAATAATGTGGCATTCATGAGCTACTTTTTACAGGGCAAGGTTGATGCCTGCCTAGAGCTCTTAATTAGAACTGGACGGCTGCCAGAAGCTGCCTTCTTGGCCCGAACTTACTTACCCAGTCAGGTTTCAAGGGTAGTGAAACTCTGGAGAGAGAATCTCTCAAAAGTCAATCAGAAAGCAGCAGAATCCCTTGCTGACCCAACAGAGTATGAAAACCTGTTCCCTGGATTAAAAGAAGCCTTTGTTGTTGAAGAATGGGTGAAGGAAACACATGCTGATCTGTGGCCAGCCAAACAATACCCACTTGTCACGCCAAATGAAGAGAGAAATGTCATGGAAGAGGGAAAAGACTTTCAGCCCTCAAGATCTACAGCTCAACAGGAACTTGATGGGAAACCTGCTTCTCCTACTCCGGTTATTGTGGCCTCCCACACAGCCAACAAAGAAGAAAAGAGTTTACTCGAACTAGAAGTAGATTTGGATAATTTGGAATTAGAAGATATTGACACAACAGATATCAATCTGGATGAAGATATTTTGGATGATTGACTGTAATGCTTTCCATTTACCTGACTAAACAGATCATTATTATATATAGGTATTGATTGCTACCCTGACCACAGTGCTTTGGACTATGAGAAACTTCTTAGATTTTTATATGTAAATGCTGTGGACCACTGGGAGCACAATGCCCACATCATCTTAAGAAGAGTTTATGTGCAGCATTTAAATCACTGTGTTTTCCTTGTTAACTAAAACAGACATGGGCTTTGATTTTTTTCATACTATTAGACCATATCTCATAAAACCTTTTGAATTAATGAAGGTACTTGTTTCCTTTCTCAATAATGAAAATAGGCTTCTAGTTTTAGAAGGCTGAGCCGAAACTACACCTTGCCTAGGGATCAGCCCCACTGTCTTTTCTTTGTATAACTAAATCTGCATTTTCAAATGTTGTCAATCACATTTTTCTTAGAGCTGAATATCCAGGCTGTAATTCTCTAAACCCTTTTTCTTGACCTCATTGCATCATTCCACAGGTCTTGCCCCGATTTTGTCTAGCAGCTACCCATTTCTGGAGTCAGGATGTGAAACCTCTGTTCCTCTGACCTCATTAAGCTGGGGGTCTGTCTAAGTTAACGTTTGCCCTATTTGGTAACACAAAAACACACCAGACTTTTTAACCGTACGCTCATCTAACATGATTTGAGAAATTCATAACCAGGCACTCAAATATCCTTGTAGCCTACGAAAAGTGAGTAGGGTAATAATTTTTGCTTTGTAGGGAGAACTACAAATTGATATCTTTTAATCTGGCCATTTTTTAACATTTAGCTCAATATTAACAGAGAAATGTAGTCAGTATTTAGTAAAATAAATGTATTTTTAAAATATTTTTAGGAAGCTGCAGAATGGCGACTGAGTGCTTCTTGATAAGTCTGCAGTGTTAGTTCTATATAGGCTCCCTTCTGTGCTTCTGTTTTTGCAAAGACCTGTTTAAATTAAAAAGAAAATTTTAAAACAATAGGACATATGCTATTTATAAAGTTTTTCAGTTTTAAGACATCATTAGCATTTCTGTAGTAGCAAAGAGTCCTACTTAAAAAGGGCTTTCAGATTTCACAATTTTTCCCCCGATTATACAATAATTAATAAACACACATGGACAGAAAAACAATACCCAACACATTTCAAGCAATACTAATTCTAAACACCAGAAGTATCCAATTAAGACCCTGACATTGTATTAATATTAATACTTCCTTCGAGATCAAAACAAAAACCATTAGGTTAGAGAGAAATCTGGAGGCTAAGAGTTACCAAACTAACTTTTGACTTTAAAGAATATTTTCTCCAAAAACATTGCGCTTTATCAGGTTCATAAAGAAAATCAGTACTGTAGTTTCTCTCTACTCTTCCTAGGATGTCATCACAGGTCATTGTTTCCTTAGCTTTGCAGCATGCAAACAGTATTACTAGGATAGAAGCCAGTTCCACAAAACCATGTATATTCTGAGCATTAGAAGAGATGAAATTAATTATACAATCTCCTCCCCTTCCCTTCCTGAAAATATCATCTCAACTCTCAGCACTTACAGATAAATGTACATAAGCCCATGGTTTTGAGAGGTATGCAGCTCCAAAATGACAATACAGCTAAGGCTTGATGATATACAAGCATCACACTCTCCACTTCTTGACACATGCCCATTTCCCCCGATGTGATGTGACCACACAAAGACAGGAAGCTGCTCTGGGGGACATGTGCTACTTAGTCCTCTACCCTGTCCTGTTGGTGGCTTGAACACCTCAGATGCAGCTCAGCCCTTCCAGTGCTCCAAAGAACAAAGGGGCTGCTCCCTGCACTGTCAGAACTTCTCTGGACTCCAGCTGCTAGCACCACATCACTCAACCTACTTTACTGCACTTTACCCCCCTCCCCTGTCTGTTTCTATTGTCCAGGCTGAAGAAATATGGGGACAAATCATACTGATGTTTTCAAGACCACAGATGTCCCATATTCACAAATCTGTTTAGTTACCATTAATTATGACCCAATTCTGAATTTTTCCCAGCTCAATTACCACCACAAAACAACCAATATGAAAAAAAAACTTTACCTTGATTAAATTTATTCCCTCAGCAGCCTGATCCTTGGCCCCTTGAGCCGACTGGCCATCTGGATGGAGCACGTGATACAGCTGGACCAAGTTGGTTGCATCATCGATTCTGAGAATGAAAGGGTTTAATGTTATCTAGGGGTTTTCTTCATTTGATTCACAGTCCTATAAAAGTGTGTGCCAACTTCAAACTAAATTACATTTCAGACTTTCCTCAGGCTGGAGGGATTGGGGAAGGACCTTCAGTTTTACAGTTTCAAAAGCATTTTCAGGAAAATTGACTAATTTAGGCCTCACACCAACTCCGTGAGGCAGCTAGGGCAGGAGTCACTGCAGGAAGTGTCCAATTTATGAAAGTGAATATATTCCAAATGTGGCTATATTCTTTTTGGAAAAAGAGCACCATTTCTCACAGAAACAGCATTCCTAATGGTAGACAATTTCCAGGCCAGCTTACTTCACCAGCATGTAATAGTCTAATCCAACTCAGAGGACAGAAACACAGCTTCATCCCACATAAGCAGGAGGGTGGTGGTCACAGGGATCTCAAAGTCACTTGCCTCTAAGTGACATTTGCTAACAGACAAATGCCTCTACAAGAGGCCCCCTAAGATTCCAAGGAAAGGATTCACAGGAACGCATTAGTAAAATAGCATCCTAGTGAAGCAAATTTGAAATTATACACACACATCAGACAAAAAGGAAAATCGGGTTCTACATCAGCAATCTGTCTTAACTTCAGCATCACACAACTACCTATGAAGAAGACAGAACAAGAATTCAGTTCTTCTGGTCTGTACTTCTCAGAAATGTATAAACAATTTTTATCAACATTAAAACTGTCCTAGCAAAACCAAACAATCACTATCTTTTCACACAGCTGACACTTTCCCACCATTTGCCATCTCATCGCTGGAGGGCACAGAAAAACGACACTCAAAATGCTTGTGCTTTTGAGGCTCTGCTATATACACTAAGTGAACTACTGGCTTCCAGTTGGGAATGGAGGGCTGAGGACACCCTAATTCAGTGCTTCCGCAGCTAGCACTCTTCAGCCTTCCCTGCGTTCCCCTTACCTGAGCTGGGGGATGAAGAGCAGGGTGACAGTGGGAGTAAGTACAGAATTCCTCAAGCCTTGGTAGCCTTAGAGAAATGCTCTGGGCTTATACTGAGGCTCATCTACCCTAAAGGCCATCTCTCAGGAAAACAGAGCTGTTGTATCATAAAGCTTTTCAGGGGGAAAAAAATAAAAAATGTTCATCACAAATCTATTGTGCTTGTTATAATCTAACAAAGTCCACTAAATGTAGTAACGAAATGTCTCCCCAATAAAAAATTAAGATTCCCTTTGGAGCTTAGGCATGTGGCCTTATAAAGAGCTTAACTGGACTGCTACCTGTTGGTATGTTCAGGGCTTCATTAGGTTCATGCTTAAGTATAATGCCTGTGCCTCACAGAACAATTTAAATTTAGCTTAACACCCCACCCATACTTAAAGAGCAAATAAATTATATTTCGAAAAGATTTTAAAATAATCTCAATATAAAAACCAACAGTGGGAACTGAGTCTGGAATAAATGTGTGCAGAATCCTAATTCTTTTCTGAGCTCCACTCAGTGAGGATATGCACCCTCTACTGTCCAGCCTGTGGTTTGCAGTAAGCTCACTCTTCTGTTCAGAATGACCACAGGAGGGCCTTTACCTAGGAATAGCAGGAAAAGCTAAGTAAGTACTCAAACTTCCCTCCCAGTAAGCATGAATTGCTTCAGATGTAAAGCTTACATGTGATGAGTAATACTATAATATCATACATTAATATATCCTAATAAACTTTAATTTTCAAACA