Transcript asmbl_98057

Sequence
Transcript Sequence for observation asmbl_98057 of TGE0059713:
CGTTTGGCAGCGGATAGAGGACACGACCAAGATGGCGGCGGTGTCTGGCTTGGTGCGGAGACCCCTTCGGGAGGTAGGCAGCAGCGCGCGGCCTGTATTCCCACGCGACCCCTGCCCACCCTGCGTCCCGCCGTCATCTTCCTCTCTCCCTGCCAGGTCTCCGGGCTGCTGAAGAGGCGCTTTCACTGGACCGCGCCGGCTGCGCTGCAGGTGACAGTTCGTGATGCTATAAATCAGGGTATGGATGAGGAGCTGGAAAGAGATGAGAAGGTATTTCTGCTTGGAGAAGAAGTTGCCCAGTATGATGGGGCATACAAGGTTAGTCGAGGGCTGTGGAAGAAATATGGAGACAAGAGGATTATTGACACTCCCATATCAGAGATGGGCTTTGCTGGAATTGCTGTAGGTGCAGCTATGGCTGGGTTGCGGCCCATTTGTGAATTTATGACCTTCAATTTCTCCATGCAAGCCATTGACCAGGTTATAAACTCAGCTGCCAAGACCTACTACATGTCTGGTGGCCTTCAGCCTGTGCCTATAGTCTTCAGAGGGCCCAATGGTGCCTCAGCAGGTGTAGCTGCCCAGCACTCACAGTGCTTTGCTGCCTGGTATGGGCACTGCCCAGGCTTAAAGGTGGTCAGTCCCTGGAATTCAGAGGATGCTAAAGGACTTATTAAATCAGCCATTCGGGATAACAATCCAGTGGTGGTGCTAGAGAATGAATTGATGTATGGGGTTCCTTTTGAATTTCCTCCGGAAGCTCAGTCAAAAGATTTTCTGATTCCTATTGGAAAAGCCAAAATAGAAAGGCAAGGAACACATATAACTGTGGTTTCCCATTCAAGACCTGTGGGCCACTGCTTAGAAGCTGCAGCAGTGCTATCTAAAGAAGGAGTTGAATGTGAGGTGATAAATATGCGTACCATTAGACCAATGGACATGGAAACCATAGAAGCCAGTGTCATGAAGACAAATCATCTTGTAACTGTGGAAGGAGGCTGGCCACAGTTTGGAGTAGGAGCTGAAATCTGTGCCAGGATCATGGAAGGTCCTGCGTTCAATTTCCTGGATGCTCCTGCTGTTCGTGTCACTGGTGCTGATGTCCCTATGCCTTATGCAAAGATTCTAGAGGACAACTCTATACCTCAGGTCAAAGACATCATATTTGCAATAAAGAAAACATTAAATATTTAGTTTGGACTTGAATATCAAGTCGTTGAAATTTATTTGAAATACTTGCTGGCACTGCACCTGGATTTGTACTGCAAGACCTGACTATTCATAACGGAAAACGATTTCTAAAGCAACAGCAGGTATTTTTGTACAGGGAAGTTTAAATGTGTTTGTGTATGGAAAACTCTCCACTCTCCTCCCCTAGATGCCATGCTTCCTTTTGTCTGTTACGGTTGCCATGTTCTTTGAATAACAAATTATATAACATTTTATCCTCTCTCACCACAAGGACAAAGTATGGATGTGGCAGAGTCCTCATGAAAGATGTATCCAAACAAGATAACTTATATGTATAAAATTAAAGCATATAATATACATTTACTGTTAGTTTGTTTTGATAAGGAATAAAGGAATTTCTAACATGA