Transcript asmbl_98056

Sequence
Transcript Sequence for observation asmbl_98056 of TGE0059712:
CGTTTGGCAGCGGATAGAGGACACGACCAAGATGGCGGCGGTGTCTGGCTTGGTGCGGAGACCCCTTCGGGAGGTCTCCGGGCTGCTGAAGAGGCGCTTTCACTGGACCGCGCCGGCTGCGCTGCAGGTGACAGTTCGTGATGCTATAAATCAGGGTATGGATGAGGAGCTGGAAAGAGATGAGAAGGTATTTCTGCTTGGAGAAGAAGTTGCCCAGTATGATGGGGCATACAAGGTTAGTCGAGGGCTGTGGAAGAAATATGGAGACAAGAGGATTATTGACACTCCCATATCAGAGATGGGCTTTGCTGGAATTGCTGTAGGTGCAGCTATGGCTGGGTTGCGGCCCATTTGTGAATTTATGACCTTCAATTTCTCCATGCAAGCCATTGACCAGGTTATAAACTCAGCTGCCAAGACCTACTACATGTCTGGTGGCCTTCAGCCTGTGCCTATAGTCTTCAGAGGGCCCAATGGTGCCTCAGCAGGTGTAGCTGCCCAGCACTCACAGTGCTTTGCTGCCTGGTATGGGCACTGCCCAGGCTTAAAGGTGGTCAGTCCCTGGAATTCAGAGGATGCTAAAGGACTTATTAAATCAGCCATTCGGGATAACAATCCAGTGGTGGTGCTAGAGAATGAATTGATGTATGGGGTTCCTTTTGAATTTCCTCCGGAAGCTCAGTCAAAAGATTTTCTGATTCCTATTGGAAAAGCCAAAATAGAAAGGCAAGGAACACATATAACTGTGGTTTCCCATTCAAGACCTGTGGGCCACTGCTTAGAAGCTGCAGCAGTGCTATCTAAAGAAGGAGTTGAATGTGAGGTGATAAATATGCGTACCATTAGACCAATGGACATGGAAACCATAGAAGCCAGTGTCATGAAGACAAATCATCTTGTAACTGTGGAAGGAGGCTGGCCACAGTTTGGAGTAGGAGCTGAAATCTGTGCCAGGATCATGGAAGGTCCTGCGTTCAATTTCCTGGATGCTCCTGCTGTTCGTGTCACTGGTGCTGATGTCCCTATGCCTTATGCAAAGATTCTAGAGGACAACTCTATACCTCAGGTCAAAGACATCATATTTGCAATAAAGAAAACATTAAATATTTAGTTTGGACTTGAATATCAAGTCGTTGAAATTTATTTGAAATACTTGCTGGCACTGCACCTGGATTTGTACTGCAAGACCTGACTATTCATAACGGAAAACGATTTCTAAAGCAACAGCAGGTATTTTTGTACAGGGAAGTTTAAATGTGTTTGTGTATGGAAAACTCTCCACTCTCCTCCCCTAGATGCCATGCTTCCTTTTGTCTGTTACGGTTGCCATGTTCTTTGAATAACAAATTATATAACATTTTATCCTCTCTCACCACAAGGACAAAGTATGGATGTGGCAGAGTCCTCATGAAAGATGTATCCAAACAAGATAACTTATATGTATAAAATTAAAGCATATAATATACATTTACTGTTAGTTTGTTTTGATAAGGAATAAAGGAATTTCTAACATGA