Transcript asmbl_97856

Sequence
Transcript Sequence for observation asmbl_97856 of TGE0058489:
TTCCCAACTTTGCTCAAAGTCGCTGGACTCTAAGCTGTCGGAGGGACCGCTGGACAGACCTGGGAACTGACAGAGGGCCTGGAGGGAAACAGGCCAAAGACCCACAGGCAGAGTTGACACGGAACCCCAAAGCAAGGAGGAGGGCTCGGGCCCGAGACCGTTCACCTCCCCTTATCCCTGTTCCCCTCTTCAGGATGGAGCTGACCTCAAGGGAAAGAGGGAGGGGACAGCCTCTGCCCTGGGAACTTCGACTGGGCCTACTGCTAAGCGTGCTGGCTGCCACACTGGCACAGGCCCCTGCCCCGGATGTGCCTGGCTGTTCCAGGGGAAGCTGCTACCCCGCCACGGGCGACCTGCTGGTGGGCCGAGCTGACAGACTGACTGCCTCATCCACTTGTGGCCTGAATGGCCCCCAGCCCTACTGCATCGTCAGTCACCTGCAGGACGAAAAGAAGTGCTTCCTTTGTGACTCCCGGCGCCCCTTCTCTGCTAGAGACAACCCACACAGCCATCGCATCCAGAATGTAGTCACCAGCTTTGCACCACAGCGGCGGGCAGCCTGGTGGCAGTCAGAGAATGGTATCCCTGCGGTCACCATCCAGCTGGACCTGGAGGCTGAGTTTCATTTCACACACCTCATTATGACCTTCAAGACATTTCGCCCTGCTGCCATGCTGGTGGAACGCTCAGCAGACTTTGGCCGCACCTGGCATGTGTACCGATATTTCTCCTATGACTGTGGGGCTGACTTCCCAGGAGTCCCACTAGCACCCCCACGGCACTGGGATGATGTAGTCTGTGAGTCCCGCTACTCAGAGATTGAGCCATCCACTGAAGGCGAGGTCATCTATCGTGTGCTGGACCCTGCCATCCCTATCCCAGACCCCTACAGCTCACGGATTCAGAACCTGTTGAAGATCACCAACCTACGGGTGAACCTGACTCGTCTACACACGTTGGGAGACAACCTACTCGACCCACGGAGGGAGATCCGAGAGAAGTACTACTATGCCCTCTATGAGCTGGTTGTACGTGGCAACTGCTTCTGCTACGGACACGCCTCAGAGTGTGCACCCGCCCCAGGGGCACCAGCCCATGCTGAGGGCATGGTGCACGGAGCTTGCATCTGCAAACACAACACACGTGGCCTCAACTGCGAGCAGTGTCAGGATTTCTATCGTGACCTGCCCTGGCGTCCGGCTGAGGACGGCCATAGTCATGCCTGTAGGAAGTGTGAGTGCCATGGGCACACCCACAGCTGCCACTTCGACATGGCCGTATACCTGGCATCTGGCAATGTGAGTGGAGGTGTGTGTGATGGATGTCAGCATAACACAGCTGGGCGCCACTGTGAGCTCTGTCGGCCCTTCTTCTACCGTGACCCAACCAAGGACCTGCGGGATCCGGCTGTGTGCCGCTCCTGTGATTGTGACCCCATGGGTTCTCAAGACGGTGGTCGCTGTGATTCCCATGATGACCCTGCACTGGGACTGGTCTCCGGCCAGTGTCGCTGCAAAGAACATGTGGTGGGCACTCGCTGCCAGCAATGCCGTGATGGCTTCTTTGGGCTCAGCATCAGTGACCGTCTGGGCTGCCGGCGATGTCAATGTAATGCACGGGGCACAGTGCCTGGGAGCACTCCTTGTGACCCCAACAGTGGATCCTGTTACTGCAAACGTCTAGTGACTGGACGTGGATGTGACCGCTGCCTGCCTGGCCACTGGGGCCTGAGCCACGACCTGCTCGGCTGCCGCCCCTGTGACTGCGACGTGGGTGGTGCTTTGGATCCCCAGTGTGATGAGGGCACAGGTCAATGCCACTGCCGCCAGCACATGGTTGGGCGACGCTGTGAGCAGGTGCAACCTGGCTACTTCCGGCCCTTCCTGGACCACCTAATTTGGGAGGCTGAGGACACCCGAGGGCAGGTGCTCGATGTGGTGGAGCGCCTGGTGACCCCCGGGGAAACTCCATCCTGGACTGGCTCAGGCTTCGTGCGGCTACAGGAAGGTCAGACCCTGGAGTTCCTGGTGGCCTCTGTGCCGAAGGCTATGGACTATGACCTGCTGCTGCGCTTAGAGCCCCAGGTCCCTGAGCAATGGGCAGAGTTGGAACTGATTGTGCAGCGTCCAGGGCCTGTGCCTGCCCACAGCCTGTGTGGGCATTTGGTGCCCAAGGATGATCGCATCCAAGGGACTCTGCAACCACATGCCAGGTACTTGATATTTCCTAATCCTGTCTGCCTTGAGCCTGGTATCTCCTACAAGCTGCATCTGAAGCTGGTACGGACAGGGGGAAGTGCCCAGCCTGAGACTCCCTACTCTGGACCTGGCCTGCTCATTGACTCGCTGGTGCTGCTGCCCCGTGTCCTGGTGCTAGAGATGTTTAGTGGGGGTGATGCTGCTGCCCTGGAGCGCCAGGCCACCTTTGAACGCTACCAATGCCATGAGGAGGGTCTGGTGCCCAGCAAGACTTCTCCCTCTGAGGCCTGCGCACCCCTCCTCATCAGCCTGTCCACCCTCATCTACAATGGTGCCCTGCCATGTCAGTGCAACCCTCAAGGTTCACTGAGTTCTGAGTGCAACCCTCATGGTGGTCAGTGCCTGTGCAAGCCTGGAGTGGTTGGGCGCCGCTGTGACCTCTGTGCCCCTGGCTACTATGGCTTTGGCCCCACAGGCTGTCAAGCCTGCCAGTGCAGCCACGAGGGGGCACTCAGCAGTCTCTGTGAAAAGACCAGTGGGCAATGTCTCTGTCGAACTGGTGCCTTTGGGCTTCGCTGTGACCGCTGCCAGCGTGGCCAGTGGGGATTCCCTAGCTGCCGGCCATGTGTCTGCAATGGGCATGCAGATGAGTGCAACACCCACACAGGCGCTTGCCTGGGCTGCCGTGATCACACAGGGGGTGAGCACTGTGAAAGGTGCATTGCTGGTTTCCACGGGGACCCACGGCTGCCATATGGGGGCCAGTGCCGGCCCTGTCCCTGTCCTGAAGGCCCTGGGAGCCAACGGCACTTTGCTACTTCTTGCCACCAGGATGAATATTCCCAGCAGATTGTGTGCCACTGCCGGGCAGGCTATACGGGGCTGCGATGTGAAGCTTGTGCCCCTGGGCACTTTGGGGACCCATCAAGGCCAGGTGGCCGGTGCCAACTGTGTGAGTGCAGTGGGAACATTGACCCAATGGATCCTGATGCCTGTGACCCCCACACGGGGCAATGCCTGCGCTGTTTACACCACACAGAGGGTCCACACTGTGCCCACTGCAAGCCTGGCTTCCATGGGCAGGCTGCCCGACAGAGCTGTCACCGCTGCACATGCAACCTGCTGGGCACAAATCCGCAGCAGTGCCCATCTCCTGACCAGTGCCACTGTGATCCAAGCAGTGGGCAGTGCCCATGCCTCCCCAATGTCCAGGGCCCTAGCTGTGACCGCTGTGCCCCCAACTTCTGGAACCTCACCAGTGGCCATGGTTGCCAGCCTTGTGCCTGCCACCCAAGCCGGGCCAGAGGCCCCACCTGCAACGAGTTCACAGGGCAGTGCCACTGCCGTGCCGGCTTTGGAGGGCGGACTTGTTCTGAGTGCCAAGAGCTCCACTGGGGAGACCCTGGGTTGCAGTGCCATGCCTGTGATTGTGACTCTCGTGGAATAGATACACCTCAGTGTCACCGCTTCACAGGTCACTGCAGCTGCCGCCCAGGGGTGTCTGGTGTGCGCTGTGACCAGTGTGCCCGTGGCTTCTCAGGAATCTTTCCTGCCTGCCATCCCTGCCATGCATGCTTCGGGGATTGGGACCGAGTGGTGCAGGACTTGGCAGCCCGTACACAGCGCCTAGAGCAGCGGGCGCAGGAGTTGCAACAGACGGGTGTGCTGGGTGCCTTTGAGAGCAGCTTCTGGCACATGCAGGAGAAGCTGGGCATTGTGCAGGGCATCGTAGGTGCCCGCAACACCTCAGCCGCCTCCACTGCACAGCTTGTGGAGGCCACAGAGGAGCTGCGGCGTGAAATTGGGGAGGCCACTGAGCACCTGACTCAGCTCGAGGCAGACCTGACAGATGTGCAAGATGAGAACTTCAATGCCAACCATGCACTAAGTGGTCTGGAGCGAGATAGGCTTGCACTTAATCTCACACTGCGGCAGCTCGACCAGCATCTTGACTTGCTCAAACATTCAAACTTCCTGGGTGCCTATGACAGCATCCGGCATGCCCATAGCCAGTCTGCAGAGGCAGAACGTCGTGCCAATACCTCAGCCCTGGCAGTACCTAGCCCTGTGAGCAACTCGGCAAGTGCTCGGCATCGGACAGAGGCACTGATGGATGCTCAGAAGGAGGACTTCAACAGCAAACACATGGCCAACCAGCGGGCACTTGGCAAGCTCTCTGCCCATACCCACACCCTGAGCCTGACAGACATAAATGAGCTGGTGTGTGGGGCACCAGGGGATGCACCCTGTGCTACAAGCCCTTGTGGGGGTGCCGGCTGTCGAGATGAGGATGGGCAGCCGCGCTGTGGGGGCCTCAGCTGCAATGGGGCAGCGGCTACAGCAGACCTAGCACTGGGCCGGGCCCGGCACACACAGGCAGAGCTGCAGCGGGCACTGGCAGAAGGTGGTAGCATCCTCAGCAGAGTGGCTGAGACTCGTCGGCAGGCAAGCGAGGCACAGCAGCGGGCCCAGGCAGCCCTGGACAAGGCTAATGCTTCCAGGGGACAGGTGGAACAGGCCAACCAGGAACTTCAAGAACTTATCCAGAGTGTGAAGGACTTCCTCAACCAGGAGGGGGCTGATCCTGATAGCATTGAAATGGTGGCCACACGGGTGCTAGAGCTCTCCATCCCAGCTTCAGCTGAGCAGATCCAGCACCTGGCGGGTGCGATTGCAGAGCGAGTCCGGAGCCTGGCAGATGTGGATGCGATCCTGGCACGTACTGTAGGAGATGTGCGTCGTGCCGAGCAGCTACTGCAGGATGCACGGCGGGCAAGGAGCTGGGCTGAGGATGAGAAACAGAAGGCAGAGACAGTACAGGCAGCACTGGAGGAGGCCCAGCGGGCACAGGGTATTGCCCAGGGTGCCATCCGGGGGGCAGTGGCTGACACACGGGACACAGAGCAGACCCTGTACCAGGTACAGGAGAGGATGGCAGGTGCAGAGCGGGCACTGAGCTCTGCAGGTGAAAGGGCTCGGCAGTTGGATGCTCTCCTGGAGGCTCTGAAATTGAAACGGGCAGGAAATAGTCTGGCAGCCTCTACAGCAGAAGAAACGGCAGGCAGTGCCCAGGGTCGTGCCCAGGAGGCTGAGCAGCTGCTACGCGGTCCTCTGGGTGATCAGTACCAGACGGTGAAGGCCCTAGCTGAGCGCAAGGCCCAAGGTGTGCTGGCTGCACAGGCAAGGGCAGAACAACTGCGGGATGAGGCTCGGGACCTGTTGCAAGCCGCTCAGGACAAGCTGCAGCGGCTACAGGAATTGGAAGGCACCTATGAGGAAAATGAGCGGGCACTGGAGAGTAAGGCAGCCCAGTTGGACGGGTTGGAGGCCAGGATGCGCAGCGTGCTTCAAGCCATCAACTTGCAGGTGCAGATCTACAACACCTGCCAGTGACCCCTGCCCAAGGCCTACCCCAGTTCCTAGCACTGCCCCACATGCATGTCTGCCTATGCACTGAAGAGCTCTTGGCCCGGCAGGGCCCCCAATAAACCAGTGTGAACCCCC