Transcript asmbl_28091

Sequence
Transcript Sequence for observation asmbl_28091 of TGE0004565:
CCGCCGCTGCTGCTGCTGCTGCTGTCGCTGCCGGAATCGCCGCAGCTCCCAGCCTCGCGCGTCGCCGCTACCTTCTCGGACAGAAATTTTATGAATAAGCATCAGAAGCCAGTGCTAACAGGCCAGCGGTTCAAAACTCGGAAAAGGGATGAAAAAGAGAAATTCGAACCTACAGTCTTCAGGGATACACTTGTCCAGGGGCTTAATGAAGCTGGTGATGACCTTGAAGCTGTAGCCAAGTTTCTGGACTCTACAGGATCAAGATTAGATTATCGTCGCTATGCAGACACACTCTTCGATATCCTGGTGGCTGGCAGTATGCTTGCCCCTGGAGGGACACGCATAGATGATGGTGACAAGACCAAGATGACCAACCACTGTGTGTTTTCAGCAAATGAAGATCATGAAACCATCCGAAACTATGCTCAGGTCTTCAATAAACTCATCAGGAGATACAAGTATTTGGAAAAGGCATTTGAGGACGAAATGAAAAAGCTTCTCCTCTTCCTTAAAGCCTTTTCCGAAACAGAGCAGACCAAGCTGGCGATGCTGTCAGGCATCCTGCTGGGCAACGGCACCCTTCCTGCCGCCATCCTCACCAGTCTCTTCACCGACAGCTTAGTCAAAGAAGGCATTGCAGCCTCATTTGCTGTCAAGCTTTTTAAAGCATGGATGGCAGAAAAAGATGCCAACTCTGTTACCTCTTCTTTGAGAAAAGCCAACTTAGACAAGAGGCTGCTTGAACTCTTTCCAGTTAACAGACAGAGTGTGGATCATTTTGCTAAATACTTCACAGACGCAGGACTAAAGGAGCTTTCTGATTTCCTGCGAGTCCAGCAGCCCCTGGGCACCAGGAAGGAACTGCAGAAGGAGCTCCAGGAGGAGCGTCTTTCAGTGATGCCCGATCAAGGAGGTGGTGCTCTATGTGAAAGAAGAAATGAAGAGGAATGACCTTCCGGAAACAGCAGTGATTGGACTTCTGTGGACCTGTATCATGAATGCTGTTGAATGGAACAAGAAGGAGGAACTCGTGGCAGAGCAGGCCCTTAAGCACCTGAAGCAATACGCTCCCCTGCTGGCTGTGTTCAGCTCCCAAGGCCAGTCAGAGCTGATCCTTCTCCAGAAGGTTCAGGAATACTGTTACGACAACATCCATTTCATGAAAGCCTTTCAGAAGATCGTGGTTCTCTTTTACAAAGCCGATGTGCTGAGTGAAGAAGCAATTTTGAAATGGTACAAAGAAGCACACGTGGCCAAAGGCAAAAGTGTTTTTCTTGACCAGATGAAGAAATTTGTTGAGTGGTTACAAAATGCAGAAGAAGAATCCGAATCGGAAGGTGAGGAAAATTAGATGACTCGAGAAGCACAATACCTAGGGTTACTACACAATACTTTGATTGGGAATGCTGAACCATTCGAGAAGAGAAACTTGGCTTCTGTTTTCACAAAGGATTAAAAATAGGATAGGGTTCCCTTGTGCAGAAGGGGAAAAGTGGTTTTGTTTTCATTTTGTTTTTAAATGGAGCCCTGAGGCATCAGCTATTACACTTGGGACTCTACCTCTCACTCACTGTATGCTAACTTAAAGCCATTCAACAAGGAGTCAAGTAGGAATCTGAAAGTAAATACTCAACGGACTCCTCTTTTTTAGCTGTATTTTTCAGGTACTGTGTGGTGAATGCCCCACTGGTGTCTATTACAGGGCCACTTTGGTAGTTGTGTATCTGCTCGTGTATGTGATTTGACAAACCAGTTTTTTTAAATAAATGGCTTTAT