Transcript asmbl_97796

Sequence
Transcript Sequence for observation asmbl_97796 of TGE0059711:
CTACGCTTGCGCGGCGCAACAGGGCCGACTGCAGCTGGAAGATGGCGGCGTCCGTGGTCTGTCGGGCCGCTACCGCCGGGGCACAAGTGCTATTGCGCGCCCGCCGCTCGCCGGCCCTGCTGCGGACGCCAGCCTTGCGGAGTACGGCAACCTTCGCTCAGGCGCTCCAGTTCGTGCCGGAGACGCAGGTTAGCCTGCTGGACAACGGCCTGCGTGTGGCCTCCGAGCAGTCCTCTCAGCCCACTTGCACGGTGGGAGTGTGGATTGATGTTGGCAGCCGTTTTGAGACTGAGAAGAATAATGGGGCAGGCTACTTTTTGGAGCATCTGGCTTTCAAGGGAACAAAGAATCGGCCTGGCAGTGCCCTGGAGAAGGAGGTGGAGAGCATGGGGGCCCATCTTAATGCCTACAGCACCCGGGAGCACACAGCTTACTACATCAAGGCGCTGTCCAAGGATCTGCCGAAAGCTGTGGAGCTCCTGGGTGACATTGTGCAGAACTGTAGTCTGGAAGACTCACAGATTGAGAAGGAACGTGATGTGATCCTGCGGGAGATGCAGGAGAATGATGCATCTATGCGAGATGTGGTCTTTAACTACCTGCATGCCACAGCATTCCAGGGCACACCTCTAGCCCAGGCTGTGGAGGGGCCCAGTGAGAATGTCAGGAAGCTGTCTCGTGCAGACTTGACCGAGTACCTCAGCACACATTACAAGGCCCCTCGAATGGTGCTGGCAGCAGCTGGAGGAGTGGAGCACCAGCAACTGTTAGACCTCGCCCAGAAGCACCTCGGTGGCATCCCATGGACATATGCAGAGGACGCTGTGCCCACTCTTACTCCATGCCGCTTCACTGGCAGTGAGATCCGCCACCGTGATGATGCTCTACCTTTTGCCCACGTGGCCATTGCAGTAGAGGGTCCTGGCTGGGCCAGCCCGGACAATGTGGCCTTGCAAGTGGCCAATGCCATCATCGGCCACTATGACTGCACTTATGGTGGTGGCGTGCACCTGTCCAGCCCACTGGCTTCAGGTGCTGTGGCCAACAAGCTATGCCAGAGTTTCCAGACCTTCAGCATCTGCTATGCAGAGACGGGCTTGCTGGGTGCACACTTTGTCTGTGACCGAATGAAAATCGATGACATGATGTTCGTCCTGCAAGGGCAGTGGATGCGCCTGTGTACCAGTGCCACGGAGAGTGAGGTGGCCCGGGGCAAAAACATCCTCAGAAATGCCCTGGTATCTCATCTAGATGGCACTACTCCTGTGTGTGAGGACATCGGACGCAGCCTCCTGACCTATGGCCGCCGCATCCCCCTGGCTGAATGGGAAAGCCGGATTGCGGAGGTGGATGCCAGTGTGGTACGTGAGATCTGCTCCAAGTACATCTATGACCAGTGCCCAGCAGTGGCTGGATATGGCCCCATTGAGCAGCTCCCAGACTACAACCGGATCCGTAGCGGCATGTTCTGGCTGCGCTTCTAGGCGGGAAGCCTATGTAAGCAAGAGGGCAGGGCCGGGGTTTGTGGTCCCCCCCCCACCACAAACACAGCACTTCGGCTCCTCTAACCTGTGCCACAGGTGACCACCAATAAAATCCTCTGCTGAG