Transcript asmbl_96969

Sequence
Transcript Sequence for observation asmbl_96969 of TGE0001673:
GCGTGGATTGTCGTCTTCTGTCCAAGTTGGTCGCTTCCCTGCGCCAAAGTGAGCAGTAGCCAACATGTCAGGGTGGGAGTCATATTACAAAACCGAGGGCGATGAAGAAGCAGAGGAAGAACAAGAAGAGAACCTTGAAGCAAGTGGAGACTATAAATATTCAGGAAGAGATAGTTTGATTTTTTTGGTTGATGCCTCCAAGGCTATGTTTGAATCTCAGAGTGAAGATGAGTTGACACCTTTTGACATGAGCATCCAGTGTATCCAAAGTGTGTACATCAGTAAGATCATAAGCAGTGATCGAGATCTCTTGGCTGTGGTGTTCTATGGTACCGAGAAAGACAAAAATTCAGTGAATTTTAAAAATATTTACGTCTTACAGGAGCTGGATAATCCAGGTGCAAAACGAATTCTAGAGCTTGACCAGTTTAAGGGGCAGCAGGGACAAAAACGTTTCCAAGACATGATGGGCCACGGATCTGACTACTCACTCAGTGAAGTGCTGTGGGTCTGTGCCAACCTCTTTAGTGATGTCCAATTCAAGATGAGTCATAAGAGGATCATGCTGTTCACCAATGAAGACAACCCCCATGGCAATGACAGTGCCAAAGCCAGCCGGGCCAGGACCAAAGCCGGTGATCTCCGAGATACAGGCATCTTCCTTGACTTGATGCACCTGAAGAAACCTGGGGGCTTTGACATATCCTTGTTCTACAGAGATATCATCAGCATAGCAGAGGATGAGGACCTCAGGGTTCACTTTGAGGAATCCAGCAAGCTAGAAGACCTGTTGCGGAAGGTTCGCGCCAAGGAGACCAGGAAGCGAGCACTCAGCAGGTTAAAGCTGAAGCTCAACAAAGATATAGTGATCTCTGTGGGCATTTATAATCTGGTCCAGAAGGCTCTCAAGCCTCCTCCAATAAAGCTCTATCGGGAAACAAATGAACCAGTGAAAACCAAGACCCGGACCTTTAATACAAGTACAGGCGGTTTGCTTCTGCCTAGCGATACCAAGAGGTCTCAGATCTATGGGAGTCGTCAGATTATACTGGAGAAAGAGGAAACAGAAGAGCTAAAACGGTTTGATGATCCAGGTTTGATGCTCATGGGTTTCAAGCCGTTGGTACTGCTGAAGAAACACCATTACCTGAGGCCCTCCCTGTTCGTGTACCCAGAGGAGTCGCTGGTGATTGGGAGCTCAACCCTGTTCAGTGCTCTGCTCATCAAGTGTCTGGAGAAGGAGGTTGCAGCATTGTGCAGATACACACCCCGCAGGAACATCCCTCCTTATTTTGTGGCTTTGGTGCCACAGGAAGAAGAGTTGGATGACCAGAAAATTCAGGTGACTCCTCCAGGCTTCCAGCTGGTCTTTTTACCCTTTGCTGATGATAAAAGGAAGATGCCCTTTACTGAAAAAATCATGGCAACTCCAGAGCAGGTGGGCAAGATGAAGGCTATCGTTGAGAAGCTTCGCTTCACATACAGAAGTGACAGCTTTGAGAACCCCGTGCTGCAGCAGCACTTCAGGAACCTGGAGGCCTTGGCCTTGGATTTGATGGAGCCGGAACAAGCAGTGGACCTGACATTGCCCAAGGTTGAAGCAATGAATAAAAGACTGGGCTCCTTGGTGGATGAGTTTAAGGAGCTTGTTTACCCACCAGATTACAATCCTGAAGGGAAAGTTACCAAGAGAAAACACGATAATGAAGGTTCTGGAAGCAAAAGGCCCAAGGTGGAGTATTCAGAAGAGGAGCTGAAGACCCACATCAGCAAGGGTACGCTGGGCAAGTTCACTGTGCCCATGCTGAAAGAGGCCTGCCGGGCTTACGGGCTGAAGAGTGGGCTGAAGAAGCAGGAGCTGCTGGAAGCCCTCACCAAGCACTTCCAGGACTGACCAGAGGCCGCGCGTCCAGCTGCCCTTCCGCAGTGTGGCCAGGCTGCCTGGCCTTGTCCTCAGCCAGTTAAAATGTGTTTCTCCTGAGCTAGGAAGAGTCTACCCGACATAAGTCGAGGGACTTTATGTTTTTGAGGCTTTCTGTTGCCATGGTGATGGTGTAGCCCTCCCACTTTGCTGTTCCTTACTTTACTGCCTGAATAAAGAGCCCTAAGTTTGTAC