Transcript asmbl_96967

Sequence
Transcript Sequence for observation asmbl_96967 of TGE0059710:
CGACCTCATCTTTGTCAGTGCACAAAATGGCGCCCTACAGCCTACTGGTGACTCGGCTGCAGAAAGCTCTGGGTGTGCGGCAGTACCATGTGGCCTCAGTCCTGTGCCAACGGGCCAAGGTGGCGATGAGCCACTTTGAGCCCAACGAGTACATCCATTATGACCTGCTAGAGAAGAACATTAACATTGTTCGCAAACGACTGAACCGGCCGCTGACACTCTCGGAGAAGATTGTGTATGGACACCTGGATGACCCCGCCAGCCAGGAAATTGAGCGAGGCAAGTCGTACCTGCGGCTGCGGCCGGACCGTGTGGCCATGCAGGATGCGACGGCCCAGATGGCCATGCTCCAGTTCATCAGCAGCGGGCTGTCCAAGGTGGCTGTGCCATCCACCATCCACTGTGACCATCTGATTGAAGCCCAGGTTGGGGGCGAGAAAGACCTGCGCCGGGCCAAGGACATCAACCAGGAAGTTTATAATTTCCTGGCAACTGCAGGTGCCAAATATGGCGTGGGCTTCTGGAAGCCTGGATCTGGAATCATTCACCAGATTATTCTGGAAAACTATGCGTACCCTGGTGTTCTTCTGATTGGCACTGACTCCCACACCCCCAATGGTGGCGGCCTTGGGGGCATCTGCATTGGAGTTGGGGGTGCCGATGCTGTGGATGTCATGGCTGGGATCCCCTGGGAGCTGAAGTGCCCCAAGGTGATTGGCGTGAAGCTGACGGGCTCTCTCTCCGGTTGGTCCTCACCCAAAGATGTGATCCTGAAGGTGGCAGGCATCCTCACGGTGAAAGGTGGCACAGGTGCAATCGTGGAATACCACGGGCCTGGTGTAGACTCCATCTCCTGCACTGGCATGGCGACAATCTGCAACATGGGTGCAGAAATTGGGGCCACCACTTCCGTGTTCCCTTACAACCACAGGATGAAGAAGTACCTGAGCAAGACCGGCCGGGAAGACATTGCCAATCTAGCTGATGAATTCAAGGATCACTTGGTGCCTGACCCTGGCTGCCATTATGACCAACTAATTGAAATTAACCTCAGTGAGCTGAAGCCACACATCAATGGGCCCTTCACCCCTGACCTGGCTCACCCTGTGGCAGAAGTGGGCAAGGTGGCAGAGAAGGAAGGATGGCCTCTGGACATCCGAGTGGGTCTAATTGGTAGCTGCACCAATTCAAGCTATGAAGATATGGGGCGCTCAGCAGCTGTGGCCAAGCAGGCACTGGCCCATGGCCTCAAGTGCAAGTCCCAGTTCACCATCACTCCAGGTTCCGAGCAGATCCGCGCCACCATTGAGCGGGACGGCTATGCACAGATCTTGAGGGATCTGGGTGGCATTGTCCTGGCCAATGCTTGTGGCCCCTGCATTGGCCAGTGGGACAGGAAGGACATCAAGAAGGGGGAGAAGAACACAATCGTCACCTCCTACAACAGGAACTTCACGGGCCGCAACGACGCAAACCCCGAGACCCATGCCTTTGTCACGTCCCCAGAGATTGTCACAGCCCTGGCCATTGCGGGAACCCTCAAGTTCAACCCAGAGACCGACTACCTGACGGGCACGGATGGCAAGAAGTTCAGGCTGGAGGCTCCGGATGCAGATGAGCTTCCCAAAGGGGAGTTTGACCCAGGGCAGGACACCTACCAGCACCCACCCAAGGACAGCAGCGGGCAGCATGTGGACGTGAGCCCCACCAGCCAGCGCCTGCAGCTCCTGGAGCCTTTTGACAAGTGGGATGGCAAGGACCTGGAGGACCTGCAGATCCTCATCAAGGTCAAAGGGAAGTGTACCACTGACCACATCTCAGCTGCTGGCCCCTGGCTCAAGTTCCGTGGGCACTTGGATAACATCTCCAACAACCTGCTCATTGGTGCCATCAACATTGAAAACGGCAAGGCCAACTCCGTGCGCAATGCCGTCACTCAGGAGTTTGGCCCCGTCCCTGACACTGCCCGCTACTACAAGAAACATGGCATCAGGTGGGTGGTGATCGGAGACGAGAACTACGGCGAGGGCTCGAGCCGGGAGCATGCAGCTCTGGAGCCTCGCCACCTTGGGGGCCGGGCCATCATCACCAAGAGCTTTGCCAGGATCCACGAGACCAACCTGAAGAAACAGGGCCTGCTGCCTCTGACCTTCGCTGACCCGGCTGACTACAACAAGATTCACCCTGTGGACAAGCTGACCATTCAGGGCCTGAAGGACTTCACCCCTGGCAAGCCCCTGAAGTGCATCATCAAGCACCCCAACGGGACCCAGGAGACCATCCTCCTGAACCACACCTTCAACGAGACGCAGATTGAGTGGTTCCGCGCTGGCAGTGCCCTCAACAGAATGAAGGAACTGCAACAGTGAGGGCAGTGCCTCCCCGCCCCGCCGCTGGCGTCAAGTTCAGCTCCACGTGTGCCATCAGTGGATCCGATCCGTCCAGCCATGGCTTCCTATTCCAAGATGGTGTGACCAGACATGCTTCCTGCTCCCCGCTTAGCCCACGGAGTGACTGTGGTTGTGGTGGGGGGGTTCTTAAAATAACTTTTTAGCCCCCGTCTTCCTATTTTGAGTTTGGTTCAGATCTTAAGCAGCTCCATGCAACTGTATTTATTTTTGATGACAAGACTCCCATCTAAAGTTTTTCTCCTGCCTGATCATTTCATTGGTGGCTGAAGGATTCTAGAGAACCTTTTGTTCTTGCAAGGAAAACAAGAATCCAAAACCAGTGACTGTTCTGTGAGTGATTGGTGTCTGTGCCGTTTGTTGTCAAGTCCAGGGTCCAGGAAGGGTCTTTTCAGTCAAGGTCAGTGGAGGCCCAACAGCCACAGCCACAGATGGATCCATCACTGCAGTGAAGGAGGAGCAGGGCCTAGATGGTGGAGGAGCGGGGCAAGCTGGTGGGCACTCCTGGCCTTGCCTCACTGTCCAGCTCGAGACACTATCTCCTTAGCATCGGCCTCAGCTGCTGTTGTCTTCACAGCCGGCCATACCACCTTCCCGCAGG