Transcript asmbl_96568

Sequence
Transcript Sequence for observation asmbl_96568 of TGE0059709:
ATTGTGTCCTCAATCACTGCTTCTCTCCGCTTTGACGGGGCCCTCAATGTGGACCTCACTGAGTTCCAGACCAACCTGGTGCCCTACCCCCGCATCCACTTCCCGCTGGTCACCTACGCGCCCATCATCTCTGCCGAGAAAGCCTATCACGAACAGCTCTCTGTGGCCGAGATAACCAGCTCCTGCTTTGAGCCCAACAGCCAGATGGTGAAGTGCGACCCGAGACATGGCAAGTACATGGCCTGCTGCATGCTCTACCGGGGCGACGTGGTGCCCAAGGATGTGAATGTCGCTATTGCTGCCATCAAGACCAAGAGGACCATCCAGTTTGTAGACTGGTGTCCCACAGGCTTCAAGGTGGGCATCAACTACCAGCCCCCGACCGTGGTCCCCGGGGGAGACCTGGCCAAGGTGCAGCGGGCCGTCTGCATGCTCAGCAACACCACGGCCATTGCGGAGGCCTGGGCCCGCCTCGACCACAAGTTCGACCTCATGTACGCCAAGCGGGCCTTTGTGCATTGGTATGTGGGAGAGGGGATGGAAGAAGGAGAATTTTCTGAGGCCAGGGAAGACTTAGCTGCCCTGGAGAAGGATTATGAAGAAGTGGGGACTGATTCGTTTGAAGAAGAAAATGAAGGGG