Transcript asmbl_94033

Sequence
Transcript Sequence for observation asmbl_94033 of TGE0001636:
CTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACATGGGTCCCTCGGCTTCCTGCCTCGGAAGCGCAGCAGCAGGCATCGTGGGAAGGTGAAGAGCTTCCCTAAGGATGACCCGTCCAAGCCGGTCCACCTCACAGCCTTCCTGGGATACAAGGCTGGCATGACTCACATCGTGCGGGAAGTCGACAGGCCGGGATCCAAGGTGAACAAGAAGGAGGTGGTGGAGGCTGTGACCATTGTAGAGACACCACCCATGGTGGTTGTGGGCATTGTGGGCTACGTGGAAACCCCTCGAGGCCTCCGGACCTTCAAGACTGTCTTTGCTGAGCACATCAGTGATGAATGCAAGAGGCGTTTCTATAAGAATTGGCATAAATCTAAGAAGAAGGCCTTTACCAAGTACTGCAAGAAATGGCAGGATGAGGATGGCAAGAAGCAGCTGGAGAAGGACTTCAGCAGCATGAAGAAGTACTGCCAAGTCATCCGTGTCATTGCCCACACCCAGATGCGCCTGCTTCCTCTGCGCCAGAAGAAGGCCCACCTGATGGAGATCCAGGTGAACGGAGGCACTGTGGCCGAGAAGCTGGACTGGGCCCGCGAGAGGCTTGAGCAGCAGGTACCTGTGAACCAAGTGTTTGGGCAGGATGAGATGATCGACGTCATCGGGGTGACCAAGGGCAAAGGCTACAAAGGGGTCACCAGTCGTTGGCACACCAAGAAGCTGCCCCGCAAGACCCACCGAGGCCTGCGCAAGGTGGCCTGTATTGGGGCATGGCATCCTGCTCGTGTAGCCTTCTCTGTGGCACGCGCTGGGCAGAAAGGCTACCATCACCGCACTGAGATCAACAAGAAGATTTATAAGATTGGCCAGGGCTACCTTATCAAGGACGGCAAGCTGATCAAGAACAATGCCTCCACTGACTATGACCTATCTGACAAGAGCATCAACCCTCTGGGTGGCTTTGTCCACTATGGTGAAGTGACCAATGACTTTGTCATGCTGAAAGGCTGTGTGGTGGGAACCAAGAAGCGGGTGCTCACCCTCCGCAAGTCCTTGCTGGTGCAGACGAAGCGGCGGGCTCTGGAGAAGATTGACCTTAAGTTCATTGACACCACCTCCAAGTTTGGCCATGGCCGCTTCCAGACCATGGAGGAGAAGAAAGCATTCATGGGACCACTGAAGAAAGACCGAATTGCAAAGGAAGAAGGAGCTTAATGCCAGGAACAGATTTTGCAGTTGGTGGGGTCTCAATAAAAGTTATTTTCCAC