Transcript asmbl_94008

Sequence
Transcript Sequence for observation asmbl_94008 of TGE0001619:
CTCAGCGGCGGCCGCCATTTTGTGCAGTCGCTGGGAAGGAAGGAGACGCCTAAACCGCGGCACTGCCCGGTTTGAGCGTAGCCAAACCTGCCCACCGGCTTTGTAGCCCCGATTCTCTGTGTTTTGCTCCCGTCTCCGACGAGAGAGGCGGCGACGGTGGCGTCTGCGACGGGAGACAGCGCGTCGGAGCGAGAGAGCGCTGCGCCTGCCGCCGCCCCAACAGCGGAGGCGCCGCCGCCATCGGTCGTCACCAGACCGGAGCCGCAGGCCCTCCCGAGCCCGGCCATCCGTGCCCCGCTCCCAGATCTCTATCCTTTTGGGACCATGCGCGGAGGAGGCTTTGGGGACCGGGACCGGGATCGTGACCGTGGAGGATTTGGAGCAAGAGGTGGTGGTGGCCTTCCCCCGAAGAAATTTGGTAATCCTGGGGAGCGTTTGCGTAAAAAAAAGTGGGATTTGAGTGAGCTCCCCAAGTTTGAGAAAAATTTTTATGTGGAACATCCGGAAGTAGCAAGGCTGACACCATATGAGGTTGATGAGCTACGCCGAAAGAAGGAGATTACAGTGAGGGGGGGAGATGTTTGTCCTAAACCCGTGTTTGCCTTCCATCATGCTAACTTCCCACAATATGTAATGGATGTGTTGATGGATCAGCACTTTACAGAACCAACTCCAATTCAGTGCCAGGGATTTCCGTTGGCTCTTAGTGGCCGGGATATGGTGGGCATTGCTCAGACTGGCTCTGGGAAGACGTTGGCGTATCTCCTGCCTGCAATTGTTCATATTAACCACCAGCCATACTTGGAAAGGGGAGATGGCCCAATCTGTCTAGTTCTGGCTCCTACCAGAGAGCTTGCCCAGCAAGTACAGCAGGTGGCCGATGACTATGGCAAATGTTCTAGATTGAAGAGTACTTGTATTTATGGAGGTGCTCCTAAAGGTCCCCAGATTCGAGACTTGGAAAGAGGTGTTGAGATCTGCATAGCCACTCCTGGACGTCTGATAGATTTCCTGGAGTCAGGAAAGACAAATCTTCGCCGATGTACTTACCTTGTATTGGACGAAGCTGACAGAATGCTTGATATGGGGTTTGAACCCCAGATCCGTAAAATTGTTGACCAAATCAGGCCTGATAGGCAGACACTGATGTGGAGTGCAACCTGGCCAAAAGAAGTAAGACAGCTT