Transcript asmbl_93947

Sequence
Transcript Sequence for observation asmbl_93947 of TGE0058482:
CCGCCCCGGAGCCGGCTCCCGGCTGGGAATGGTCCCGCGGCTCCGAGGGCGGGGCGGGAAGGCGGCGAGGAGCCGAGCTGGGTGCGGTGAGGCGCGCAGATCACCGCGGTTCCTGGGCAGGGCACGGAAGGCTAAGCAAGGCTGACCTGCTGCAGCTCCCGCCTCGTGCGCTCGCCCCACCCGGCCGCCGCCCGAGCGCTCGAGAAAGTCCTCTCGGGAGAAGCAGCGCCTGTTCCCGGGGCAGATCCAGGTTCAGGTCCTGGCTATAAGTCACCATGGCACAGCAAGCTGCCGATAAGTATCTCTATGTGGATAAAAACTTCATCAACAATCCGCTGGCCCAGGCCGACTGGGCTGCCAAGAAGCTGGTATGGGTGCCTTCCGACAAGAGTGGCTTTGAGCCAGCCAGCCTCAAGGAGGAGGTGGGCGAAGAGGCCATCGTGGAGCTGGTGGAGAATGGGAAGAAGGTGAAGGTGAACAAGGATGACATCCAGAAGATGAACCCGCCCAAGTTCTCCAAGGTGGAGGACATGGCAGAGCTCACGTGCCTCAACGAAGCCTCGGTGCTGCACAACCTCAAGGAGCGTTACTACTCAGGGCTCATCTACACCTATTCAGGCCTGTTCTGTGTGGTCATCAATCCTTACAAGAACCTGCCCATCTACTCTGAAGAGATTGTGGAAATGTACAAGGGCAAGAAGAGGCACGAGATGCCCCCTCACATCTATGCCATCACAGACACCGCCTACAGGAGTATGATGCAAGACCGAGAAGATCAATCCATCTTGTGCACTGGTGAATCTGGAGCTGGCAAGACGGAGAACACCAAGAAGGTCATCCAGTATCTGGCGTACGTGGCGTCCTCGCACAAGAGCAAGAAGGACCAGGGCGAGCTGGAGCGGCAGCTGCTGCAGGCCAACCCCATCCTGGAGGCCTTCGGGAACGCCAAG