Transcript asmbl_93741

Sequence
Transcript Sequence for observation asmbl_93741 of TGE0059708:
CTCGCCGGGACAACGGGGTGAGGGCATGGGGGCGTGGGGCCCCAGCCTATGTTCCCCGCGGCACTGGCGCGGCGGCCGCGCCGACCGAAGTCCGGGACGGGGGAGGGGCCCGAGCGCCAGCGGCCGGGCGGGAGTCTCAGGAGCGGGTTCCCGGTCCCTGCAGGCGGCCTGGCGGGTGGCATCGAGATCTGCATCACCTTCCCCACCGAGTACGTGAAGACGCAGCTGCAGCTGGACGAGCGCTCGCACCCGCCGCGGTACCGGGGCATCGGGGACTGCGTGCGGCAGACGGTTCGCAGCCATGGCGTCCTGGGCCTGTACCGCGGCCTTAGCTCCCTGCTCTACGGTTCCATCCCCAAGGCGGCCGTCAGGTTTGGAATGTTCGAGTTCCTCAGCAACCACATGCGGGATGCCCAGGGACGGCTGGACAGCACGCGTGGGCTGCTGTGCGGCCTGGGCGCTGGCGTGGCCGAGGCCGTGGTGGTCGTGTGCCCCATGGAGACCATCAAGGTGAAGTTCATCCACGACCAGACCTCCCCAAACCCCAAGTACAGAGGATTCTTCCACGGGGTTAGGGAGATTGTGCGGGAACAAGGGCTGAAGGGGACGTACCAGGGCCTCACAGCCACTGTCCTGAAGCAGGGCTCGAACCAGGCCATCCGCTTCTTCGTCATGACCTCCCTGCGCAACTGGTACCGAGGGGACAACCCCAACAAGCCCATGAACCCTCTGATCACTGGGGTCTTCGGAGCTATTGCAGGCGCAGCCAGTGTCTTTGGAAACACTCCTCTGGATGTGATTAAGACCCGGATGCAGGGCCTGGAGGCGCACAAATACCGGAACACGTGGGACTGCGGCTTGCAGATCCTGAAGAAGGAGGGGCTCAAGGCATTCTACAAGGGCACTGTCCCCCGCCTGGGCCGGGTCTGCCTGGATGTGGCCATAGTGTTTGTCATCTATGATGAAGTGGTGAAGCTGCTCAACAAAGTGTGGAAGACGGACTAAGCCTAGAGAGGCCGCAAGGGGACCGCCCCAGGCACCGCCAGAGTGTCCTGCTACCTTTGTCTCACGATTCCAGTGCAGTAGTGCCAAAAGGCCCCTTCCCACGTCCCTCGAGCTCTGTAGCCTGGTCTGTGCATTGTGGCTGTCAAATCCATGTGTCCCCCCTGTGGTCTGTGTGTGACACCACCACTGTGTCCCAGTGTCTGGCCCAGCCATGGCTGGATGTGCATCTGGCCTATGACCCTGTGCCTGTGTTTCATGTTCTGTGTCACGTGACCCTGTGCCCCGCCTCCCGGGGTGCCCGTGTGGCCTGGGTCCTCGGCCCTGTAGCCCTGGCCCGGTCCCAGTCCGGTGCCTTCCACCCTGCCCTGGCCTACCACAGCTGCCTCCGGGCCTCGGCCTGGCTTCACCGCATTCCAGGGGCTGCAGCCCCCTGCTTCTCCCGCCATTGGCCTTAACTGGCCCTCGGGCCCTCTCTCCGCCCCGGACAGGGTGGCACCCACCACTCTCAGGACCACCCTGCCAAGGCAGAATAAACCGGATCCTGTTGCAGCC