Transcript asmbl_93740

Sequence
Transcript Sequence for observation asmbl_93740 of TGE0059707:
CGTGGGCTGGGGAGTCGTGGAGGCGCGGTCCTGGTCCCCACCCGGCGCGCTGGGACTCGCCCGCCTCCCGTCTGTCACCCCCTGCGCCTCGCCGGGACAACGGGGCGGCCTGGCGGGTGGCATCGAGATCTGCATCACCTTCCCCACCGAGTACGTGAAGACGCAGCTGCAGCTGGACGAGCGCTCGCACCCGCCGCGGTACCGGGGCATCGGGGACTGCGTGCGGCAGACGGTTCGCAGCCATGGCGTCCTGGGCCTGTACCGCGGCCTTAGCTCCCTGCTCTACGGTTCCATCCCCAAGGCGGCCGTCAGGTTTGGAATGTTCGAGTTCCTCAGCAACCACATGCGGGATGCCCAGGGACGGCTGGACAGCACGCGTGGGCTGCTGTGCGGCCTGGGCGCTGGCGTGGCCGAGGCCGTGGTGGTCGTGTGCCCCATGGAGACCATCAAGGTGAAGTTCATCCACGACCAGACCTCCCCAAACCCCAAGTACAGAGGATTCTTCCACGGGGTTAGGGAGATTGTGCGGGAACAAGGGCTGAAGGGGACGTACCAGGGCCTCACAGCCACTGTCCTGAAGCAGGGCTCGAACCAGGCCATCCGCTTCTTCGTCATGACCTCCCTGCGCAACTGGTACCGAGGGGACAACCCCAACAAGCCCATGAACCCTCTGATCACTGGGGTCTTCGGAGCTATTGCAGGCGCAGCCAGTGTCTTTGGAAACACTCCTCTGGATGTGATTAAGACCCGGATGCAGGGCCTGGAGGCGCACAAATACCGGAACACGTGGGACTGCGGCTTGCAGATCCTGAAGAAGGAGGGGCTCAAGGCATTCTACAAGGGCACTGTCCCCCGCCTGGGCCGGGTCTGCCTGGATGTGGCCATAGTGTTTGTCATCTATGATGAAGTGGTGAAGCTGCTCAACAAAGTGTGGAAGACGGACTAAGCCTAGAGAGGCCGCAAGGGGACCGCCCCAGGCACCGCCAGAGTGTCCTGCTACCTTTGTCTCACGATTCCAGTGCAGTAGTGCCAAAAGGCCCCTTCCCACGTCCCTCGAGCTCTGTAGCCTGGTCTGTGCATTGTGGCTGTCAAATCCATGTGTCCCCCCTGTGGTCTGTGTGTGACACCACCACTGTGTCCCAGTGTCTGGCCCAGCCATGGCTGGATGTGCATCTGGCCTATGACCCTGTGCCTGTGTTTCATGTTCTGTGTCACGTGACCCTGTGCCCCGCCTCCCGGGGTGCCCGTGTGGCCTGGGTCCTCGGCCCTGTAGCCCTGGCCCGGTCCCAGTCCGGTGCCTTCCACCCTGCCCTGGCCTACCACAGCTGCCTCCGGGCCTCGGCCTGGCTTCACCGCATTCCAGGGGCTGCAGCCCCCTGCTTCTCCCGCCATTGGCCTTAACTGGCCCTCGGGCCCTCTCTCCGCCCCGGACAGGGTGGCACCCACCACTCTCAGGACCACCCTGCCAAGGCAGAATAAACCGGATCCTGTTGCAGCC