Transcript asmbl_93739

Sequence
Transcript Sequence for observation asmbl_93739 of TGE0059706:
GGCTGGGGGCGGGGCCTGGCTCGGACCACGCGGGGCGGGACCTGGAGCTGACGCGGCCGCCCCGCCCCTGGGACCATAACCGGCCGCCGCCGCCACCGCGGACCGAGCGCGGAGTTCTGGAGTCTCGGACCCGAAGCCGCCACAGGGCGCCCCGCCTCCCGCCCGCCATGCCCGCGCCCCGCGCCCCGCGCGCTCTGGCGGCCGCCGCGCCCGCGTCCGGGAAGGCCAAGCTGACGCACCCGGGGAAGGCGATCCTGGCAGGCGGCCTGGCGGGTGGCATCGAGATCTGCATCACCTTCCCCACCGAGTACGTGAAGACGCAGCTGCAGCTGGACGAGCGCTCGCACCCGCCGCGGTACCGGGGCATCGGGGACTGCGTGCGGCAGACGGTTCGCAGCCATGGCGTCCTGGGCCTGTACCGCGGCCTTAGCTCCCTGCTCTACGGTTCCATCCCCAAGGCGGCCGTCAGGTTTGGAATGTTCGAGTTCCTCAGCAACCACATGCGGGATGCCCAGGGACGGCTGGACAGCACGCGTGGGCTGCTGTGCGGCCTGGGCGCTGGCGTGGCCGAGGCCGTGGTGGTCGTGTGCCCCATGGAGACCATCAAGGTGAAGTTCATCCACGACCAGACCTCCCCAAACCCCAAGTACAGAGGATTCTTCCACGGGGTTAGGGAGATTGTGCGGGAACAAGGGCTGAAGGGGACGTACCAGGGCCTCACAGCCACTGTCCTGAAGCAGGGCTCGAACCAGGCCATCCGCTTCTTCGTCATGACCTCCCTGCGCAACTGGTACCGAGGGGACAACCCCAACAAGCCCATGAACCCTCTGATCACTGGGGTCTTCGGAGCTATTGCAGGCGCAGCCAGTGTCTTTGGAAACACTCCTCTGGATGTGATTAAGACCCGGATGCAGGGCCTGGAGGCGCACAAATACCGGAACACGTGGGACTGCGGCTTGCAGATCCTGAAGAAGGAGGGGCTCAAGGCATTCTACAAGGGCACTGTCCCCCGCCTGGGCCGGGTCTGCCTGGATGTGGCCATAGTGTTTGTCATCTATGATGAAGTGGTGAAGCTGCTCAACAAAGTGTGGAAGACGGACTAAGCCTAGAGAGGCCGCAAGGGGACCGCCCCAGGCACCGCCAGAGTGTCCTGCTACCTTTGTCTCACGATTCCAGTGCAGTAGTGCCAAAAGGCCCCTTCCCACGTCCCTCGAGCTCTGTAGCCTGGTCTGTGCATTGTGGCTGTCAAATCCATGTGTCCCCCCTGTGGTCTGTGTGTGACACCACCACTGTGTCCCAGTGTCTGGCCCAGCCATGGCTGGATGTGCATCTGGCCTATGACCCTGTGCCTGTGTTTCATGTTCTGTGTCACGTGACCCTGTGCCCCGCCTCCCGGGGTGCCCGTGTGGCCTGGGTCCTCGGCCCTGTAGCCCTGGCCCGGTCCCAGTCCGGTGCCTTCCACCCTGCCCTGGCCTACCACAGCTGCCTCCGGGCCTCGGCCTGGCTTCACCGCATTCCAGGGGCTGCAGCCCCCTGCTTCTCCCGCCATTGGCCTTAACTGGCCCTCGGGCCCTCTCTCCGCCCCGGACAGGGTGGCACCCACCACTCTCAGGACCACCCTGCCAAGGCAGAATAAACCGGATCCTGTTGCAGCC