Transcript asmbl_93269

Sequence
Transcript Sequence for observation asmbl_93269 of TGE0056333:
AATGGGTTCAAAGCCTTTATTGGGTCAGGGCTTGCTCCAGAGCTCAGGGGCCAGGTAGGTCAGGAGCCTTGGGATGGCTGCAGGGGGAGGGAGGCCGGGCAGCCTGCGGAGGGCCTGGGGAGACCTGGGGCTGGGCGGGGGCCGGGGCTACGGGGACCCCGTGGGAGGAGCTGGAGAGGTGCAGGCCCAGGGCGTCGTCCGAGTGAGCAGCGGTGCTGGCCGTGTGGGACCCGGGCCCGCTTAGCACCATGGACGGGGTGGGCTCACGACCCTCGACTGCGGGGCCCGGGCGGCGGCGCTAGCAGATCCAGCGGATGAAGCGGTCGAAGAAGCCGGGTTGCGCCAGGCTGTCATAGTCCTTCTCGTGGAACACGGCGGCGCGGTCACCCAGGCTGAGCGTGGTGAGCACGTCCATGTCCACGTCGCTGCCCAAGGCCAGCACGGTGGGTACCACGTTCTGCTTGCGCATGGAGTGCGCCGACTCGTGCAGACTGTCGTTGCCCGTGACGCCGTCCGTGAGGAACACGAAGGACAGCTCTGCGTGCCTCCGGGCCCCGCCACGCGGGCTGCGCACGATGGCATTGATGGCGTGCACCACGCCTGCGCCCACGTGCGAGAAGGAGTTCAGGTATTGTGTGGTCTCCAGCGCCTCGTGGATGGCCGTGAGGTTGTGGCTCAGCGGGAAGGCCACCTGCTGCTCGCCGGGGCCACCAAACTGCAGCAGCGCCACGCGTGCGTTGAGAGGGTCGTCGTCCCTCCGGGCCAGCGTCAGCCGCCGCGCCACCTGCTCCACGAAGCGCCGGGCCTTGTGGAAGTTCTGCTCACCCAGCCGCTCGGAGCCGTCCAGCAGGAAGACGATGTCCACGGGCCGCTGCGTGCACTGTGCCACGGACAGCTCTGTGGGGAGACGCAGGTGCGGGCTGGGCGGAGGGGAGGTGGGCAGGACCGGGCAGGTGCCAGCCCCGCACCTGTGCCCTTCCATTCGCACCCTGCCTGCAACCTCACAGACCACTGGGCTCTGCGGGGGCGTTTCTGCAGGGCAGCCCTGGGTGTGGGTCCTTAGCCCAAGACACTTTCAGGCGGCACTGCTGGGAGCCGCCATCTCCTCTGCTGGTGCTCCCAGGCCTGAGACCCTGACACAGGCCCCAGGCCCTGTCCACCTGCTGAGCACCATCCCTGCACAGGCTGCCCTCCTGGGAGGGAAGGGGCCCAAAGCATCCTTTCATGGCTCAAGAATTTGCTGCCCACAAAAGGGCCACTGTCTGTGTAGTGTGGGAGGTACTTAAGGAGGACCCTGGCTCTGACACCCCCAGCCTGACCCCTCAATCGCTGGGTCCCAGAGCTGCTCAGAACACCTAGAGCTGGCTGGGCCACGTCCCTCCCGGAAAGACCAGGAGCCCCTGACTCTTCTGATTGGCCATGGTGGGGAGCAGTGGGCACAGGGGCAGCCAGACCTTCTGTGGCAGCCCAGGTGGGTTCTGCCCTATGACTCTGTTACCAAGTGGGGCCCCCACCTGCCTGGGTGGTCACCAGCCCTGGGCATCGGGGACAGCTTGGGGGCCTGGCCATAGCCACAACCCAGGCCAGGCTGCCTACCACACGTGTGGGTGTCACGTGGGGCCAGAGACCACAGGACAGGACACGGACAGTCCTTGCGTGGACCTGGCCCTGTGGCCTCACCAAGACCTCAGCTCCTGGGATGGGGGAGGGGAGGGACAGAGCCAGTTTCCCCAAGGGTGTCTGCTTCTCAGCCCAACCCCTGGACGTCGTCACAGCTGGTACATGGACCCCCAGGAATGCACACAGAGGACCCTGACCCGAAACTCGGTTTCTGGGGGCCCTGGAGGTGCAACGGTCCAGCCCCGCAGGCAGTGAGCAAAGCTCTGAACACAGCAGGGTGACCTCACGCTGCACCGCAGCCTTCACAGAACGCTTGAGACATGGACGCCGTCTGAGCACGCACGAGCTGGCAGATGGGGTTCCCTCAGTGAGCTTATGAGTGACGCAGCTCATTCAGTGAAAGGAAGGGCAGCCTCCCTGTTAAGGCCACACCTAGGAACCGGCTTAAATGTCCAGAAACTCCTCAGGTACCGCTGGGCTTCCCAAACCCCCTCAAAACTAATAACATTTTCACTGCTGTCACCAAACATATGGAGACAGACATGCAAGGGGCAGCTGGTTTTGGGGGTCTCTGTCCATTCATCAGTGTCTGTGGGGCCTGGAGGAGACGGGGAAGCTGTGGGGGCCGGCCAGGCACAGGGAGGCTGAGGCTGTTGGGATGTCTGTGGACTCTGCTCTCCTCCTCCTGTGGAGGATCCTTCATCCCCACAGTGGGAAGACCAGCCTGGCCTGCCCTGTGCAGTGGGTGTGGGGACGAGAACCTGGCCCTGAGAAATGGTCACAGCCGTGCCCGGCAGGAGCCCAGCCTGGATGAGGGCTCCTGCAGTCAGAACGTCGGGGTCAGCTCGCCGTGGGGGCCGCTCCCTTTGGATGGTGATCCCTGCCGCTCCCCAACATTGTGGACCCTGGGATTCTCTGCTCAGTCCTCTGAGGACCGCAGAGGTTGTGCCTGGTGGATGCTCCCCCGACTGTGCTTTTGGAGACCCAGAGGTTGGGCTGGAAGGGTGCAGACACCCCGGGATCAGGGCTGCTGGCAGGCAGCTGTGGCCATTCGCCCTACTGTGCATGACACCAGCCCAGATACGTCATGGTGCCAGGACTGCCAGCTTCCCCCAGGACTATCTGCTGCCCAACCGGAAGCCTTCACCTGCCACCAGGTGGGCCGTGAGCGCCCACGAGTCACCATGCACGGGATTAGTGCCCACACCCAGCGAGGCTCACCAGCCTCTGGGGCCTGTTTCCGAGGCTCCGCTGGAACCTGGTGCTGGAACATCCTCCAGCACCTGGGCAGCACCCTCCCTCAGCCCCATCCCAGACGCACGGCAGCCCAGCTGGGCCGCTAAGTAAGGGCCTCCAAAGACTTCCACACCCAAACCCTGGAGCCTGTGAGGGTGACCTGATGCAGCAAAGAAGGACTCTGCAGACGGGAGTGAGTTAAGGGTCTTGCGAGGTCATTCTGGACTTGGGGTGGGCCTTAAATTCAATGACCAGGGTTCTTATAAAGAGAGCGGCCACAGGAAGACGGAGGAGAGACTGGAAGATGCAGCCGCAGCAAGGGACACGGTGGCCACCAGCATGGGAAGAGGCTGGGAGCTGCCCCAGAGCCCCTGGAAGGACTGTAGCCCCGCTGACCCCGATTCCAGATCTCTGGCCTCCACTGAGAGCCAGCCTGTCGGGGGCAGCCCTGGGAAGCTAGTGTGGCAGGGAGGGCCCAGCCCGGCTGGGCGGGTGCCCGGGCTTTAGCAGAGGGCCAGCGCGGTCTCGGGGTCCCCCACGATGTCCCTGTGCACCAGCTTAAAGGTGTCAATGAACAGCTCCATCCAGTCCTGCCGCTCTACCCCGGTGGCGAACTTGGCCCGCTCGGCGGTGTAGACCAGCACGGCCACCAGCTGGGAGTAGGCGGCCGGGTCCTGCGTGAGCTCCGTGGCGTTTAGCAACTGTTGGATCAGGGGAATGGTCCTGGGGAAGGTGGCGTCCGGCCCCTCTTCCGTGCGGAGGAAGGTGACCGGGGGCTCGCCGCCAGGCCACGGTGCATCTGCAAGGGAGCGTCCAGAGAAGACTGTAAGGCCTGCGGTGGGCGTCGGCCTAGAGCTCCTCCTCGGGCAGCCGCTCAGCGAGGCCAGAGTGAAGAGCGGCATTTGGGCTGGCGAGTCGGTAGAGGAAATGCAGGTGGAGCGGGTGTGTGGCTCGGCCTTGGCAGGAGGCGTGGGGGCAGTGAGCACAGGGACAGGAAGCTGGCAGGGAGCTAGGAGACCCGCACGGTGGCACCTTTGGGGGACACCACGGACCCCGAGAAAACCTTTCAGCACAAAACAGCTCCGTCCAAACCTGTGCCGGAGACAGGCCAAACTCCAGTAGGGCTTCCAGTGCCGCAGGCCCGTCGCCAGGAAGACCCCAGCCACCCCTCAAGAGCCCGCCTGAGAAAGCTTGCGGTGGTAAACCCTTCCTCAGCCTCTCTGGGATGTGAGTCCTCTACACCCAGAACTGTCTTCCCCTGAGCAGACCTGGCCTCTGCAACGTCTCTGCCTTTTCTTTCCACCGACTGGAGCTCAGGTTACGCTGTGGCCCCTATGCAGCTCTTATCGCTGATTGCGCCCTGCCCTGACTGCCTTCAGCTGCGTCTGGTTTGTTTCTCCAGCACCCTCTGGTCCCCACGCAACTGAGAACTCCACAGGCCTGCTGCAGGCCCAGGGTGGCTGGGCTTTGGGGTGGACAGGGCTGTCTGGAGAAGGCCAGGGCCAGGCCACAGCCAGTGGTGTCCACCCAGTGCCCAGGAGGGCCGAGGAGGATGCCTGGCCGTGTGGGCTGGTGAAAGCCGATTTAACACTGTCCCTGCTGCATCTCCTGGAGCCACAAGGTCGAGTTCACTTTGAAATTGGAAACAGCTGGGAAGGAGGATGAGCTCTGAGTGTCGGGGATGAGGTGTCAGGGCGGCCGAGAGGAGGGGAGGGGTTCTGCCAGGGCTGCTCCCACTCACTGTCAGGTCCTGGAGGCCTCAGAAGAGGCCAGAGCTTCAAGGGCCTCCGTGTCCTCCCTGGCTGCTTTCCCTGTGGTGCTCTGGTGGCCTGAGTGACCCACTCCCAGGAGGGAGAATGGGCTCACTCCATGTCACCGTCTGGGGAGGAGCCACCACAGGACCCTACGAGGCCCACGTCACCCTGAGGCCAGAACCAGAGAGATCACGAGAAAAGAAAAGTGCAGGCTGATGTCGCCGATAAGCGCAAACCCTCAGGCAGGCATCAGCGAATCAGGGCCCACGTGCATAAACAGGGCCACACACCACGGCCAGGTGGGTTTATCCCGGGCACGCAGGGCTGGCTCAACACTGGAAATTCAATGACGCTCAACGGGCTAACTAACTCCCAACTACAATGATAGGCTAAAGAGGAAAGGTCACGTGACATCCACAGACGCAGCACCCACCCACTCACGATAGAACCTGGAGTGGAGGGGAAGCCATAGCGGCCACTCACACTGGACCCAGAGTGGAGAGGAAGGCCCCCCACCTGATAGCAAAGCACCCACAGTGACCATCGCCATGTCGCCCATCATGGGGTCCCGAGACTTCCCTGCCCCATCAGGAACGAGGGGGTGGGTGGAGGAGCCAAGGTCTGGTTCCTGCCCTCAGGGTCCAGGTGCCCCTGCTGCTGATGTGGACCCTGGGGGAGGACGCCTGCACCTTGGCGGCAGAAGCACAGCCCACTGTTGTGGGGCCAGAGGCTGCCCGCCTGCTGAAGGGCAGCCAGACCCAGGTGCAAGCCCTAGG