Transcript asmbl_92006

Sequence
Transcript Sequence for observation asmbl_92006 of TGE0001566:
CACGCTGCTTTCCCAGAAGGCTGTGCGTGCTCCTCGCTTCCTCCGCGGTCTTCCGAGCGGTCGCGTGAACTGCTTCCTGCAGGCTGGCCATGGCGCTTCACGTTCCCAAGGCTCCGGGCTTTGCCCAGATGCTCAAGGAGGGAGCGAAACACTTTTCAGGATTAGAAGAGGCTGTGTATAGAAACATACAAGCTTGCAAGGAGCTTGCCCAAACCACTCGTACAGCATATGGACCAAATGGAATGAACAAAATGGTTATCAACCACTTGGAGAAGTTGTTTGTGACAAACGATGCAGCAACTATTTTAAGAGAACTAGAAGTACAGCATCCTGCTGCAAAAATGATTGTAATGGCTTCTCATATGCAAGAGCAAGAAGTTGGAGATGGCACAAACTTTGTTCTGGTATTTGCTGGAGCTCTCCTGGAATTAGCTGAAGAACTTCTGAGGATTGGCCTGTCAGTTTCAGAGGTCATAGAAGGTTATGAAATAGCCTGCAGAAAAGCTCATGAGATTCTTCCTAATTTGGTATGTTGTTCTGCAAAAAACCTTCGAGATATTGATGAAGTCTCATCTCTACTTCGTACCTCCATAATGAGTAAACAATATGGTAATGAAGTATTTCTGGCCAAGCTTATTGCTCAGGCATGCGTATCTATTTTTCCTGATTCCGGCCATTTCAATGTTGATAACATCAGAGTTTGTAAAATTCTGGGCTCTGGTATCAGTTCCTCTTCAGTATTGCATGGCATGGTTTTTAAGAAGGAAACCGAAGGTGATGTAACATCTGTCAAAGATGCAAAAATAGCAGTGTACTCTTGTCCTTTTGATGGCATGATAACAGAAACTAAGGGAACAGTGTTGATAAAGACTGCTGAAGAATTGATGAATTTTAGTAAGGGAGAAGAAAACCTCATGGATGCACAAGTCAAAGCTATTGCTGATACTGGTGCAAATGTCGTAGTAACAGGTGGCAAAGTGGCAGACATGGCTCTTCATTATGCAAATAAATATAATATCATGTTAGTGAGGCTAAACTCAAAATGGGATCTCCGAAGACTTTGTAAAACTGTTGGTGCTACAGCTCTTCCTAGATTGACACCTCCTGTCCTTGAAGAAATGGGACACTGTGACAGTGTTTACCTCTCAGAAGTTGGAGATACTCAGGTGGTGGTTTTTAAGCATGAAAAGGAAGATGGCGCCATTTCTACCATAGTACTTCGAGGCTCTACAGACAATCTGATGGATGACATAGAAAGGGCAGTAGACGATGGTGTTAATACTTTCAAAGTTCTTACAAGGGATAAACGTCTTGTACCCGGAGGTGGAGCAACAGAAATTGAATTAGCCAAACAGATCACATCATATGGAGAGACATGTCCTGGACTTGAACAGTATGCTATTAAGAAGTTTGCTGAGGCATTTGAAGCTATTCCCCGCGCACTGGCAGAAAACTCTGGAGTTAAGGCCAATGAAGTAATCTCTAAACTTTATGCAGTACATCAAGAAGGAAATAAAAACGTTGGATTAGATATTGAGGCTGAAGTCCCTGCTGTAAAGGACATGCTGGAAGCTGGTATTCTAGATACTTACCTGGGAAAATATTGGGCTATCAAACTCGCTACTAATGCTGCAGTCACTGTACTTAGAGTGGATCAGATCATCATGGCAAAACCAGCTGGTGGGCCCAAGCCTCCAAGTGGGAAGAAAGACTGGGATGATGACCAAAATGATTGAAATTGGCTTAATTTTTACTGTAGGTGAAGGCTGTATTTGTAGTAGTACTCAAGAATCACCTGATGTTTTCTTATTCTCCTTAAATTAAGAGTTATTTTGTGTTTGTATTCTTGGCTGGATGTTATAATAAACATATTGTTACTGTCAAA