Transcript asmbl_91901

Sequence
Transcript Sequence for observation asmbl_91901 of TGE0059704:
CGCCCCATCGCTGCGCCCCTCCCGGCCTGGAGCCCACCAGGGCCCCGCCAGGCCCAGGAGAAGCTGCAGACGGAGGCGGCTCCCCAGGGCGGCGGGACCCGGGCTGACAGCGACCCGCAGCCCCTGCCGGGCCGCCCACACCCGCCCTGGGACTCCGCCGGGGCGCTGGTGGAACCGCTGGGCCTGGGTCTCCACTGCTGGCAACCGAACGGATCGGCCCTCTGTGGAGCCGCAGGTGTGCGGGCGAGCGGCGCCCATCCGGGCTGTGCCAGCAGAACCCCGGTGCCCGCGCCTAGGACGCCCCTGGAGAAGGGACCTTCCCTTTGGGGTCGGAACCCAGAAAGGAGGGGCCTGCGATCCGCGGAGCTCCTTGTTCTTGGGATAACACAGCTCTGGCTTGGAGGCCCCCTTGCACTTCGACTCTGGACTTCAGGGCCACAGGTGCTGCCAAGATGCTCCAGGGCACCTGCTCCGTGCTCCTGCTCTGGGGAATCCTGGGGGCCATCCAGGCCCAGCAGCAGGAGGTCATCTCGCCGGACACTACCGAGAGAAACAACAACTGCCCAGAGAAGACCGACTGCCCCATCCACGTGTACTTCGTGCTGGACACCTCGGAGAGCGTCACCATGCAGTCCCCCACGGACATCCTGCTCTTCCACATGAAGCAGTTCGTGCCGCAGTTCATCAGCCAGCTGCAGAACGAGTTCTACCTGGACCAGGTGGCGCTGAGCTGGCGCTACGGCGGCCTGCACTTCTCTGACCAGGTGGAGGTGTTCAGCCCACCGGGCAGCGACCGGGCCTCCTTCATCAAGAACCTGCAGGGCATCAGCTCCTTCCGCCGCGGCACCTTCACCGACTGCGCGCTGGCCAACATGACGGAGCAGATCCGGCAGGACCGCAGCAAGGGCACCGTCCACTTCGCCGTGGTCATCACCGACGGCCACGTCACCGGCAGCCCCTGCGGGGGCATCAAGCTGCAGGCCGAGCGGGCCCGCGAGGAGGGCATCCGGCTCTTCGCCGTGGCCCCCAACCAGAACCTGAAGGAGCAGGGCCTGCGGGACATCGCCAGCACGCCGCACGAGCTCTACCGCAACGACTACGCCACCATGCTGCCCGACTCCACCGAGATCGACCAGGACACCATCAACCGCATCATCAAGGTCATGAAACACGAAGCCTACGGAGAGGTGAGTGGCGCTTCCCTTCCTGCCAGTGCTGGCCGGCAGCTGACCCAGCAGAGATGACCGCGCCAGGCTGCCGACTCCTGGCGCCTCCAGGCTGGAACAGATGAGAGGAGAGGGAGTCACCTGCTCCATGTTGGACCTGAGGCCTTGGAGTCTGGAGAAAGGGCTCCCAGCCAAAGCTAGGCTGTTTAGATCCCGTGAGGGTCAGCGTTAGGGTCACCCACAGAGCACGTGTTACAAGGAGAGGTCGAGGGTCTGGCCTCCGGGCAGGTGGGATCCATCCACCCTGGACTCGAGGCCCGAGCCCAGCCCAGCAGGTCAGGGGAGAAGGAACTGACATCATCGGGGTCCATGACATCCCCACCTCCCTGTGTGTCCCAGCTCCAGCTCTCAGGAAGGGGAGCAGGCATCTGAGATCTCCCCCGTGAGGCTTCCTGCAAAAACGTGCCCTGCCTCAGAATCGCTGCTCAGTAACAGTGGTTTCATTGCCGTGTACAAATGGTGCCTCCCTCACCAGTGCCCCTTGCTCTTCCATCCTTTTGTAAAATTTATTCTTTTATATTTGTTTTTTTAGAGACAGGGTCTTTCTCTGTCACCTAGGCTGGAGTGCA