Transcript asmbl_91900

Sequence
Transcript Sequence for observation asmbl_91900 of TGE0059703:
CTCGGCCCGGGCTGCAGGGGGGTCCCCACCCTCTCCACCTCCTCCAGCCTCCCGCCCTCGAGGGTCCCCGCTTCCCTCCCATCCCCCTCCCGTGCCCCCGGCCCCCTCCTCCCATCCGCGGGGCCGCAGCGCTTCCTGGCGGCGGGGCGGGTCAGGCCGGCGGGGCGGGGTATAAAGGGGGCGGCGCCGGCCGCGGTTCCCTCCCTGCTGCTTACTCGGCGCCCGCGCCTCGGGCCGTCGGGAGCGGAGCCTCCTCGGGACCAGGACTTCAGGGCCACAGGTGCTGCCAAGATGCTCCAGGGCACCTGCTCCGTGCTCCTGCTCTGGGGAATCCTGGGGGCCATCCAGGCCCAGCAGCAGGAGGTCATCTCGCCGGACACTACCGAGAGAAACAACAACTGCCCAGAGAAGACCGACTGCCCCATCCACGTGTACTTCGTGCTGGACACCTCGGAGAGCGTCACCATGCAGTCCCCCACGGACATCCTGCTCTTCCACATGAAGCAGTTCGTGCCGCAGTTCATCAGCCAGCTGCAGAACGAGTTCTACCTGGACCAGGTGGCGCTGAGCTGGCGCTACGGCGGCCTGCACTTCTCTGACCAGGTGGAGGTGTTCAGCCCACCGGGCAGCGACCGGGCCTCCTTCATCAAGAACCTGCAGGGCATCAGCTCCTTCCGCCGCGGCACCTTCACCGACTGCGCGCTGGCCAACATGACGGAGCAGATCCGGCAGGACCGCAGCAAGGGCACCGTCCACTTCGCCGTGGTCATCACCGACGGCCACGTCACCGGCAGCCCCTGCGGGGGCATCAAGCTGCAGGCCGAGCGGGCCCGCGAGGAGGGCATCCGGCTCTTCGCCGTGGCCCCCAACCAGAACCTGAAGGAGCAGGGCCTGCGGGACATCGCCAGCACGCCGCACGAGCTCTACCGCAACGACTACGCCACCATGCTGCCCGACTCCACCGAGATCGACCAGGACACCATCAACCGCATCATCAAGGTCATGAAACACGAAGCCTACGGAGAGGTGAGTGGCGCTTCCCTTCCTGCCAGTGCTGGCCGGCAGCTGACCCAGCAGAGATGACCGCGCCAGGCTGCCGACTCCTGGCGCCTCCAGGCTGGAACAGATGAGAGGAGAGGGAGTCACCTGCTCCATGTTGGACCTGAGGCCTTGGAGTCTGGAGAAAGGGCTCCCAGCCAAAGCTAGGCTGTTTAGATCCCGTGAGGGTCAGCGTTAGGGTCACCCACAGAGCACGTGTTACAAGGAGAGGTCGAGGGTCTGGCCTCCGGGCAGGTGGGATCCATCCACCCTGGACTCGAGGCCCGAGCCCAGCCCAGCAGGTCAGGGGAGAAGGAACTGACATCATCGGGGTCCATGACATCCCCACCTCCCTGTGTGTCCCAGCTCCAGCTCTCAGGAAGGGGAGCAGGCATCTGAGATCTCCCCCGTGAGGCTTCCTGCAAAAACGTGCCCTGCCTCAGAATCGCTGCTCAGTAACAGTGGTTTCATTGCCGTGTACAAATGGTGCCTCCCTCACCAGTGCCCCTTGCTCTTCCATCCTTTTGTAAAATTTATTCTTTTATATTTGTTTTTTTAGAGACAGGGTCTTTCTCTGTCACCTAGGCTGGAGTGCA