Transcript asmbl_91898

Sequence
Transcript Sequence for observation asmbl_91898 of TGE0059035:
CTCGGCCCGGGCTGCAGGGGGGTCCCCACCCTCTCCACCTCCTCCAGCCTCCCGCCCTCGAGGGTCCCCGCTTCCCTCCCATCCCCCTCCCGTGCCCCCGGCCCCCTCCTCCCATCCGCGGGGCCGCAGCGCTTCCTGGCGGCGGGGCGGGTCAGGCCGGCGGGGCGGGGTATAAAGGGGGCGGCGCCGGCCGCGGTTCCCTCCCTGCTGCTTACTCGGCGCCCGCGCCTCGGGCCGTCGGGAGCGGAGCCTCCTCGGGACCAGGACTTCAGGGCCACAGGTGCTGCCAAGATGCTCCAGGGCACCTGCTCCGTGCTCCTGCTCTGGGGAATCCTGGGGGCCATCCAGGCCCAGCAGCAGGAGGTCATCTCGCCGGACACTACCGAGAGAAACAACAACTGCCCAGAGAAGACCGACTGCCCCATCCACGTGTACTTCGTGCTGGACACCTCGGAGAGCGTCACCATGCAGTCCCCCACGGACATCCTGCTCTTCCACATGAAGCAGTTCGTGCCGCAGTTCATCAGCCAGCTGCAGAACGAGTTCTACCTGGACCAGGTGGCGCTGAGCTGGCGCTACGGCGGCCTGCACTTCTCTGACCAGGTGGAGGTGTTCAGCCCACCGGGCAGCGACCGGGCCTCCTTCATCAAGAACCTGCAGGGCATCAGCTCCTTCCGCCGCGGCACCTTCACCGACTGCGCGCTGGCCAACATGACGGAGCAGATCCGGCAGGACCGCAGCAAGGGCACCGTCCACTTCGCCGTGGTCATCACCGACGGCCACGTCACCGGCAGCCCCTGCGGGGGCATCAAGCTGCAGGCCGAGCGGGCCCGCGAGGAGGGCATCCGGCTCTTCGCCGTGGCCCCCAACCAGAACCTGAAGGAGCAGGGCCTGCGGGACATCGCCAGCACGCCGCACGAGCTCTACCGCAACGACTACGCCACCATGCTGCCCGACTCCACCGAGATCGACCAGGACACCATCAACCGCATCATCAAGGTCATGAAACACGAAGCCTACGGAGAGTGCTACAAGGTGAGCTGCCTGGAAATCCCTGGGCCCTCTGGCCCCAAGGGCTACCGTGGACAGAAGGGTGCCAAGGGCAACATGGGTGAGCCGGGAGAGCCTGGCCAGAAGGGAAGACAGGGAGACCCGGGCATCGAAGGCCCCATTGGATTCCCAGGACCCAAGGGCGTTCCTGGCTTCAAAGGAGAGAAGGGTGAATTTGGAGCCGACGGTCGCAAGGGGGCCCCTGGCCTGGCTGGCAAGAACGGGACCGATGGACAGAAGGGCAAGCTGGGGCGCATCGGACCTCCTGGCTGCAAGGGAGACCCTGGAAACCGGGGCCCCGACGGTTACCCGGGGGAAGCAGGGAGTCCAGGGGAGCGAGGAGACCAAGGCGGCAAGGGGGACCCTGGCCGCCCAGGACGCAGAGGGCCCCCGGGAGAAATCGGGGCCAAGGGAAGCAAGGGGTATCAAGGCAACAGTGGAGCCCCAGGAAGTCCTGGTGTGAAAGGAGCCAAGGGCGGGCCTGGGCCCCGCGGACCCAAAGGCGAGCCGGGGCGCAGGGGAGACCCCGGCACCAAGGGCAGCCCAGGCAGCGATGGCCCCAAGGGGGAGAAGGGGGACCCTGGCCCTGAGGGGCCCCGCGGCCTGGCTGGAGAGGTTGGCAACAAAGGAGCCAAGGGAGACCGAGGCTTGCCTGGACCCAGAGGCCCCCAGGGAGCTCTTGGGGAGCCCGGAAAGCAGGGATCTCGGGGAGACCCCGGTGATGCAGGACCCCGTGGAGACTCAGGACAGCCAGGCCCCAAGGGAGACCCCGGCAGGCCTGGATTCAGCTACCCAGGACCCCGAGGAGCACCCGGAGAAAAAGGCGAGCCCGGCCCACGCGGCCCCGAGGGAGGCCGAGGCGACTTTGGCTTGAAAGGAGAACCTGGGAGGAAAGGAGAGAAAGGAGAGCCTGCGGATCCTGGTCCCCCTGGTGAGCCAGGCCCTCGGGGGCCAAGAGGAGTCCCAGGACCCGAGGGTGAGCCCGGCCCCCCTGGAGACCCCGGTCTCACGGAGTGTGACGTCATGACCTACGTGAGGGAGACCTGCGGGTGCTGCGACTGTGAGAAGCGCTGTGGCGCCCTGGACGTGGTCTTCGTCATCGACAGCTCCGAGAGCATTGGGTACACCAACTTCACACTGGAGAAGAACTTCGTCATCAACGTGGTCAACAGGCTGGGTGCCATCGCTAAGGACCCCAAGTCCGAGACAGGGACGCGTGTGGGCGTGGTGCAGTACAGCCACGAGGGCACCTTTGAGGCCATCCAGCTGGACGACGAACGTATCGACTCCCTGTCGAGCTTCAAGGAGGCTGTCAAGAACCTCGAGTGGATTGCGGGCGGCACCTGGACACCCTCAGCCCTCAAGTTTGCCTACGACCGCCTCATCAAGGAGAGCCGGCGCCAGAAGACACGTGTGTTTGCGGTGGTCATCACGGACGGGCGCCACGACCCTCGGGACGATGACCTCAACTTGCGGGCGCTGTGCGACCGCGACGTCACAGTGACGGCCATCGGCATCGGGGACATGTTCCACGAGAAGCACGAGAGTGAAAACCTCTACTCCATCGCCTGCGACAAGCCACAGCAGGTGCGCAACATGACGCTGTTCTCCGACCTGGTCGCTGAGAAGTTCATCGATGACATGGAGGACGTCCTCTGCCCGGACCCTCAGATCGTGTGCCCAGACCTTCCCTGCCAAACAGAGCTGTCCGTGGCACAGTGCACGCAGCGGCCCGTGGACATCGTCTTCCTGCTGGACGGCTCCGAGCGGCTGGGTGAGCAGAACTTCCACAAGGCCCGGCGCTTCGTGGAGCAGGTGGCGCGGCGGCTGACGCTGGCCCGGAGGGACGACGACCCTCTCAACGCACGCGTGGCGCTGCTGCAGTTTGGTGGCCCCGGCGAGCAGCAGGTGGCCTTCCCGCTGAGCCACAACCTCACGGCCATCCACGAGGCGCTGGAGACCACACAATACCTGAACTCCTTCTCGCACGTGGGCGCAGGCGTGGTGCACGCCATCAATGCCATCGTGCGCAGCCCGCGTGGCGGGGCCCGGAGGCACGCAGAGCTGTCCTTCGTGTTCCTCACGGACGGCGTCACGGGCAACGACAGTCTGCACGAGTCGGCGCACTCCATGCGCAAGCAGAACGTGGTACCCACCGTGCTGGCCTTGGGCAGCGACGTGGACATGGACGTGCTCACCACGCTCAGCCTGGGTGACCGCGCCGCCGTGTTCCACGAGAAGGACTATGACAGCCTGGCGCAACCCGGCTTCTTCGACCGCTTCATCCGCTGGATCTGCTAGCGCCGCCGCCCGGGCCCCGCAGTCGAGGGTCGTGAGCCCACCCCGTCCATGGTGCTAAGCGGGCCCGGGTCCCACACGGCCAGCACCGCTGCTCACTCGGACGACGCCCTGGGCCTGCACCTCTCCAGCTCCTCCCACGGGGTCCCCGTAGCCCCGGCCCCCGCCCAGCCCCAGGTCTCCCCAGGCCCTCCGCAGGCTGCCCGGCCTCCCTCCCCCTGCAGCCATCCCAAGGCTCCTGACCTACCTGGCCCCTGAGCTCTGGAGCAAGCCCTGACCCAATAAAGGCTTTGAACCCATT