Transcript asmbl_91267

Sequence
Transcript Sequence for observation asmbl_91267 of TGE0001512:
GGAATAGGAGCGTTGCGAGACGGTCGGTTCCAAGTGGGCCTGGGCGCGGGGGAGAGGCGGGTCTGTCCTCGGGAACTGCAAGGCCCTGTGAGCGGGAGGACTGGGATCCCGGCCGCGGCTGCTGGAAGCGTCGAAGCTCAGCGGGGCCGCGGACACTGACCTGTGCTTAGAACTCATCCTGGCCCGCAGAGCCTGCCGCGAGTCCCTGGCGTCCCCTGTGGCGGGCTCTTGGAGCCACTTTCCCGAGCGGAAGTCAGCCCGCGGCTCGGACTCCGGCGGGACCTGCTCGGAGGAATGGCGCCGCCGGGTTCAAGCACTGTCTTCCTGTTGGCCCTGACAATCATAGCCAGCACCTGGGCTCTGACGCCCACTCACTACCTCACCAAGCATGACGTGGAGAGACTAAAAGCCTCGCTGGATCGCCCTTTCACAAATTTGGAATCTGCCTTCTACTCCATCGTGGGACTCAGCAGCCTTGGTGCTCAGGTGCCAGATGCAAAGAAAGCATGTACCTACATCAGATCTAACCTTGATCCCAGCAATGTGGATTCCCTCTTCTACGCTGCCCAGGCCAGCCAGGCCCTCTCAGGATGTGAGATCTCTATTTCAAATGAGACCAAAGATCTGCTTCTGGCAGCTGTCAGTGAGGACTCATCTGTTACCCAGATCTACCATGCAGTTGCAGCTCTAAGTGGCTTTGGCCTTCCCTTGGCATCCCAAGAAGCACTCAGTGCCCTTACTGCTCGTCTCAGCAAGGAGGAGACTGTGCTGGCAACAGTCCAGGCTCTGCAGACAGCATCCCACCTGTCCCAGCAGGCTGACCTGAGGAGCATCGTGGAGGAGATTGAGGACCTTGTTGCTCGCCTGGATGAACTCGGGGGCGTGTATCTCCAGTTTGAAGAAGGACTGGAAACAACAGCGTTATTTGTGGCTGCCACCTACAAGCTCATGGATCATGTGGGGACTGAGCCATCCATTAAGGAGGATCAGGTCATCCAGCTGATGAACGCGATCTTCAGCAAGAAGAACTTTGAGTCCCTCTCCGAAGCCTTCAGCGTGGCCTCTGCAGCTGCTGTGCTCTCGCATAATCGCTACCACGTGCCAGTTGTGGTTGTGCCTGAGGGCTCTGCTTCCGACACTCATGAACAGGCTATCTTGCGGTTGCAAGTCACCAATGTTCTGTCTCAGCCTCTGACTCAGGCCACTGTTAAACTAGAACATGCTAAATCTGTTGCTTCCAGAGCCACTGTCCTCCAGAAGACATCCTTCACCCCTGTAGGGGATGTTTTTGAACTAAATTTCATGAACGTCAAATTTTCCAGTGGTTATTATGACTTCCTTGTCGAAGTTGAAGGTGACAACCGGTATATTGCAAATACCGTAGAGCTCAGAGTCAAGATCTCCACTGAAGTTGGCATCACAAATGTTGATCTTTCCACCGTGGATAAGGATCAGAGCATTGCACCCAAAACTACCCGGGTGACATACCCAGCCAAAGCCAAGGGCACATTCATCGCAGACAGCCACCAGAACTTCGCCTTGTTCTTCCAGCTGGTAGATGTGAACACTGGTGCTGAACTCACTCCTCACCAGACATTTGTCCGACTCCATAACCAGAAGACTGGCCAGGAAGTGGTGTTTGTTGCCGAGCCAGACAACAAGAACGTGTACAAGTTTGAACTGGATACCTCTGAAAGAAAGATTGAATTTGACTCTGCCTCTGGCACCTACACTCTCTACTTAATCATTGGAGATGCCACTTTGAAGAACCCAATCCTCTGGAATGTGGCTGATGTGGTCATCAAGTTCCCTGAGGAAGAAGCTCCCTCGACTGTCTTGTCCCAGAACCTTTTCACTCCAAAACAGGAAATTCAGCACCTGTTCCGCGAGCCTGAGAAGAGGCCCCCCACCGTGGTGTCCAATACATTCACTGCCCTGATCCTCTCGCCGTTGCTTCTGCTCTTCGCTCTGTGGATCCGGATTGGTGCCAATGTCTCCAACTTCACTTTTGCTCCTAGCACGATTATATTTCACCTGGGACATGCTGCTATGCTGGGACTCATGTATGTCTACTGGACTCAGCTCAACATGTTCCAGACCTTGAAGTACCTGGCCATCCTGGGCAGTGTGACGTTTCTGGCTGGCAATCGGATGCTGGCCCAGCAGGCAGTCAAGAGAACAGCACATTAGTTCCAGAAGAAAGATGGAAATTCTGAAAACTGAATGTCAAGAAAAGGAGTCAAGAACAATTCACAGTATGAGAAGAAAAATGGAAAAAAAAAACTTTATTTAAAAAAGAAAAAAGTCCAGATTGTAGTTATACTTTTGCTTGTTTTTCAGTTTCCCCAACACACAGCAGATACCTGGTGAGCTCAGATAGTCTCTTTCTCTGACACTGTGTAAGAAGCTGTGAATATTCCTAACTTACCCAGATGTTGCTTTTGAAAAGTTGAAATGTGTAATTGTTTTGGAATAAAGAGGGTAACAATAGG