Transcript asmbl_91266

Sequence
Transcript Sequence for observation asmbl_91266 of TGE0059696:
GGAATAGGAGCGTTGCGAGACGGTCGGTTCCAAGTGGGCCTGGGCGCGGGGGAGAGGCGGGTCTGTCCTCGGGAACTGCAAGGCCCTGTGAGCGGGAGGACTGGGATCCCGGCCGCGGCTGCTGGAAGCGTCGAAGCTCAGCGGGGCCGCGGACACTGACCTGTGCTTAGAACTCATCCTGGCCCGCAGAGCCTGCCGCGAGTCCCTGGCGTCCCCTGTGGCGGGCTCTTGGAGCCACTTTCCCGAGCGGAAGTCAGCCCGCGGCTCGGACTCCGGCGGGACCTGCTCGGAGGAATGGCGCCGCCGGGTTCAAGCACTGTCTTCCTGTTGGCCCTGACAATCATAGCCAGCACCTGGGCTCTGACGCCCACTCACTACCTCACCAAGCATGACGTGGAGAGACTAAAAGCCTCGCTGGATCGCCCTTTCACAAATTTGGAATCTGCCTTCTACTCCATCGTGGGACTCAGCAGCCTTGGTGCTCAGGTGCCAGATGCAAAGAAAGCATGTACCTACATCAGATCTAACCTTGATCCCAGCAATGTGGATTCCCTCTTCTACGCTGCCCAGGCCAGCCAGGCCCTCTCAGGATGTGAGATCTCTATTTCAAATGAGACCAAAGATCTGCTTCTGGCAGCTGTCAGTGAGGACTCATCTGTTACCCAGATCTACCATGCAGTTGCAGCTCTAAGTGGCTTTGGCCTTCCCTTGGCATCCCAAGAAGCACTCAGTGCCCTTACTGCTCGTCTCAGCAAGGAGGAGACTGTGCTGGCAACAGTCCAGGCTCTGCAGACAGCATCCCACCTGTCCCAGCAGGCTGACCTGAGGAGCATCGTGGAGGAGATTGAGGACCTTGTTGCTCGCCTGGATGAACTCGGGGGCGTGTATCTCCAGTTTGAAGAAGGACTGGAAACAACAGCGTTATTTGTGGCTGCCACCTACAAGCTCATGGATCATGTGGGGACTGAGCCATCCATTAAGGAGGATCAGGTCATCCAGCTGATGAACGCGATCTTCAGCAAGAAGAACTTTGAGTCCCTCTCCGAAGCCTTCAGCGTGGCCTCTGCAGCTGCTGTGCTCTCGCATAATCGCTACCACGTGCCAGTTGTGGTTGTGCCTGAGGGCTCTGCTTCCGACACTCATGAACAGGCTATCTTGCGGTTGCAAGTCACCAATGTTCTGTCTCAGCCTCTGACTCAGGCCACTGTTAAACTAGAACATGCTAAATCTGTTGCTTCCAGAGCCACTGTCCTCCAGAAGACATCCTTCACCCCTGTAGGGGATGTTTTTGAACTAAATTTCATGAACGTCAAATTTTCCAGTGGTTATTATGACTTCCTTGTCGAAGTTGAAGGTGACAACCGGTATATTGCAAATACCGTAGAGCTCAGAGTCAAGATCTCCACTGAAGTTGGCATCACAAATGTTGATCTTTCCACCGTGGATAAGGATCAGAGCATTGCACCCAAAACTACCCGGGTGACATACCCAGCCAAAGCCAAGGGCACATTCATCGCAGACAGCCACCAGAACTTCGCCTTGTTCTTCCAGCTGGTAGATGTGAACACTGGTGCTGAACTCACTCCTCACCAGACATTTGTCCGACTCCATAACCAGAAGACTGGCCAGGAAGTGGTGTTTGTTGCCGAGCCAGACAACAAGAACGTGTACAAGTTTGAACTGGATACCTCTGAAAGAAAGATTGAATTTGACTCTGCCTCTGGCACCTACACTCTCTACTTAATCATTGGAGATGCCACTTTGAAGAACCCAATCCTCTGGAATGTGGTATGTGCCTGAATGTACCCCGACCCAGGTGAGAGTGGCTGTGCCCC