Transcript asmbl_91005

Sequence
Transcript Sequence for observation asmbl_91005 of TGE0057460:
GCCTGGTTCCGCGCGCCGGAGCGCGCTAGCCGCATTGCGAGCCGAACCCGGGAGCTGGCGCCATGGTGCTGTTGCACGTGCTGTTTGAGCACGCGGTCGGCTACGCGCTGCTGGCGCTGAAGGAAGTGGAGGAGATCAGTCTGCTGCAGCCGCAGGTGGAGGAGTCTGTGCTCAACCTGGGCAAATTCCACAGCATCGTTCGTCTGGTGGCCTTTTGTCCCTTTGCCTCATCCCAGGTTGCCTTGGAAAATGCCAACGCCGTGTCTGAAGGGGTTGTTCATGAGGACCTCCGCCTGCTCTTGGAGACCCACCTGCCGTCCAAAAAGAAGAAAGTACTCTTGGGAGTTGGGGATCCCAAGATTGGTGCCGCAATACAGGAGGAGTTAGGGTACAACTGCCAGACTGGAGGAGTCATAGCTGAGATCCTGCGAGGAGTTCGTCTGCACTTCCACAATCTGGTGAAGGGTCTGACCGATCTGTCAGCTTGTAAAGCACAGCTGGGGCTGGGACACAGCTATTCCCGTGCCAAAGTTAAGTTTAATGTGAACCGGGTGGACAATATGATCATCCAGTCCATTAGCCTCCTGGACCAGCTGGATAAGGACATCAATACCTTCTCTATGCGTGTCAGGGAGTGGTACGGGTATCACTTTCCGGAGCTGGTGAAGATCATCAACGACAATGCCACATACTGCCGTCTTGCCCAGTTTATTGGAAACCGAAGGGAACTGAATGAGGACAAGCTGGAGAAGCTGGAGGAGCTGACAATGGATGGGGCCAAGGCTAAGGCTATTCTGGATGCCTCACGGTCCTCCATGGGCATGGACATATCTGCCATTGACTTGATAAACATCGAGAGCTTCTCCAGTCGTGTGGTGTCTTTATCTGAATACCGCCAGAGCCTACACACTTACCTGCGCTCCAAGATGAGCCAAGTAGCCCCCAGCCTGTCAGCCCTAATTGGGGAAGCGGTAGGTGCACGTCTCATCGCACATGCTGGCAGCCTCACCAACCTGGCCAAGTATCCAGCATCCACAGTGCAGATCCTTGGGGCTGAAAAGGCCCTGTTCAGGTACCAGTGAGGGCACCTGCCCACAATCAGGTGCCACTTCTGGTGCCCACTGCTTGTTGGGGGATCACGGTGATGGCTGACCAGGGCTCCCTGACCTATACAGGCCTCTGCTATGGGGGTGATGGCCAGTCCTGGTGTCTGAGTGATTCCCAGGGCCCAGCAAAGGGACCAAGTTTCCAGAGCCCTGAAGACAAGGGGTAACACTCCAAAATATGGACTCATTTTCCACTCCACCTTCATTGGCCGAGCAGCTGCCAAGAACAAAGGCCGCATCTCCCGATACCTGGCAAACAAATGCAGTATTGCCTCACGAATCGATTGCTTCTCTGAGGTGCCCACGAGTGTATTCGGGGAGAAGCTTCGAGAACAAGTTGAAGAGCGACTGTCCTTCTATGAGACTGGAGAGATACCACGAAAGAATCTGGATGTCATGAAGGAAGCAATGGTTCAGGCAGAGGAAGCGGCTGCTGAGATTACTAGGAAGCTGGAGAAACAGGAGAAGAAACGCTTAAAGAAGGAAAAGAAACGGCTGGCTGCACTTGCCCTCGCGTCTTCAGAAAACAGCAGTAGTACTCCAGAGGAGTGTGAGGAGATGAGTGAAAAACCCAAAAAGAAGAAAAAGCAAAAGCCCCAGGAGGTTCCTCAGGAGAATGGAATGGAAGACCCATCTATCTCTTTCTCCAAACCCAAGAAAAAGAAATCTTTTTCCAAGGAGGAGTTGATGAGTAGCGATCTTGAAGAGACCGCTGGCAGCACCAGTATTCCCAAGAGGAAGAAGTCTACACCCAAGGAGGAAACAGTTAATGACCCTGAGGAGGCAGGCCACAGAAGTGGCTCCAAGAAAAAGAGGAAATTCTCCAAAGAGGAGCCGGTCAGCAGTGGGCCTGAAGAGGCGGTTGGCAAGAGCAGCTCCAAGAAGAAGAAAAAGTTCCATAAAGCATCCCAGGAAGATTAGAATGCAAATGGACATTCTCTGGGAGGTGGGGCATACCATAGCCCAAGGTGACATTTCCCACCCTGTGCCGTGTTCCCCAATAAAAACAAATTCACAAG