Transcript asmbl_91003

Sequence
Transcript Sequence for observation asmbl_91003 of TGE0057460:
GCCTGGTTCCGCGCGCCGGAGCGCGCTAGCCGCATTGCGAGCCGAACCCGGGAGCTGGCGCCATGGTGCTGTTGCACGTGCTGTTTGAGCACGCGGTCGGCTACGCGCTGCTGGCGCTGAAGGAAGTGGAGGAGATCAGTCTGCTGCAGCCGCAGGTGGAGGAGTCTGTGCTCAACCTGGGCAAATTCCACAGCATCGTTCGTCTGGTGGCCTTTTGTCCCTTTGCCTCATCCCAGGTTGCCTTGGAAAATGCCAACGCCGTGTCTGAAGGGGTTGTTCATGAGGACCTCCGCCTGCTCTTGGAGACCCACCTGCCGTCCAAAAAGAAGAAAGTACTCTTGGGAGTTGGGGATCCCAAGATTGGTGCCGCAATACAGGAGGAGTTAGGGTACAACTGCCAGACTGGAGGAGTCATAGCTGAGATCCTGCGAGGAGTTCGTCTGCACTTCCACAATCTGGTGAAGGGTCTGACCGATCTGTCAGCTTGTAAAGCACAGCTGGGGCTGGGACACAGCTATTCCCGTGCCAAAGTTAAGTTTAATGTGAACCGGGTGGACAATATGATCATCCAGTCCATTAGCCTCCTGGACCAGCTGGATAAGGACATCAATACCTTCTCTATGCGTGTCAGGGAGTGGTACGGGTATCACTTTCCGGAGCTGGTGAAGATCATCAACGACAATGCCACATACTGCCGTCTTGCCCAGTTTATTGGAAACCGAAGGGAACTGAATGAGGACAAGCTGGAGAAGCTGGAGGAGCTGACAATGGATGGGGCCAAGGCTAAGGCTATTCTGGATGCCTCACGGTCCTCCATGGGCATGGACATATCTGCCATTGACTTGATAAACATCGAGAGCTTCTCCAGTCGTGTGGTGTCTTTATCTGAATACCGCCAGAGCCTACACACTTACCTGCGCTCCAAGATGAGCCAAGTAGCCCCCAGCCTGTCAGCCCTAATTGGGGAAGCGGTAGGTGCACGTCTCATCGCACATGCTGGCAGCCTCACCAACCTGGCCAAGTATCCAGCATCCACAGTGCAGATCCTTGGGGCTGAAAAGGCCCTGTTCAGGTACCAGTGAGGGCACCTGCCCACAATCAGGTGCCACTTCTGGTGCCCACTGCTTGTTGGGGGATCACGGTGATGGCTGACCAGGGCTCCCTGACCTATACAGGCCTCTGCTATGGGGGTGATGGCCAGTCCTGGTGTCTGAGTGATTCCCAGGGCCCAGCAAAGGGACCAAGTTTCCAGGTCAGCGACATTGGATGCCTTCCCTCTGCCTCTGGGAGCTATGGGTTGGCATGCATTGGGGTAGAGATCCAATCTGGCCTGAGGCTCACTCAGGACTTCGGGGTGAGAGGAGGGGAGGAGCTGAGCTGCCTTGGCTAATGGGGTTGAAATTTCTGATCTTAAACTCTCCACTGAATATTCTCTCAGAGCCCTGAAGACAAGGGGTAACACTCCAAAATATGGACTCATTTTCCACTCCACCTTCATTGGCCGAGCAGCTGCCAAGAACAAAGGCCGCATCTCCCGATACCTGGCAAACAAATGCAGTATTGCCTCACGAATCGATTGCTTCTCTGAGGTGCCCACGAGTGTATTCGGGGAGAAGCTTCGAGAACAAGTTGAAGAGCGACTGTCCTTCTATGAGACTGGAGAGATACCACGAAAGAATCTGGATGTCATGAAGGAAGCAATGGTTCAGGCAGAGGAAGCGGCTGCTGAGATTACTAGGAAGCTGGAGAAACAGGAGAAGAAACGCTTAAAGAAGGAAAAGAAACGGCTGGCTGCACTTGCCCTCGCGTCTTCAGAAAACAGCAGTAGTACTCCAGAGGAGTGTGAGGAGATGAGTGAAAAACCCAAAAAGAAGAAAAAGCAAAAGCCCCAGGAGGTTCCTCAGGAGAATGGAATGGAAGACCCATCTATCTCTTTCTCCAAACCCAAGAAAAAGAAATCTTTTTCCAAGGAGGAGTTGATGAGTAGCGATCTTGAAGAGACCGCTGGCAGCACCAGTATTCCCAAGAGGAAGAAGTCTACACCCAAGGAGGAAACAGTTAATGACCCTGAGGAGGCAGGCCACAGAAGTGGCTCCAAGAAAAAGAGGAAATTCTCCAAAGAGGAGCCGGTCAGCAGTGGGCCTGAAGAGGCGGTTGGCAAGAGCAGCTCCAAGAAGAAGAAAAAGTTCCATAAAGCATCCCAGGAAGATTAGAATGCAAATGGACATTCTCTGGGAGGTGGGGCATACCATAGCCCAAGGTGACATTTCCCACCCTGTGCCGTGTTCCCCAATAAAAACAAATTCACAAG