Transcript asmbl_90933

Sequence
Transcript Sequence for observation asmbl_90933 of TGE0059496:
GAATCACTGCAGCCCCCCTCGCCCTGAGCCAGAGCACCCCGGGTCCCGCCAGCCCCTCACACTCCCAGCAAAATGGGCAAGGAGAAGACCCACATCAACATCGTGGTCATCGGCCACGTGGACTCCGGAAAGTCCACCACCACGGGCCACCTCATCTACAAATGCGGAGGTATTGACAAAAGGACCATTGAGAAGTTCGAGAAGGAGGCGGCTGAGATGGGGAAGGGATCCTTCAAGTATGCCTGGGTGCTGGACAAGCTGAAGGCGGAGCGTGAGCGCGGCATCACCATCGACATCTCCCTCTGGAAGTTCGAGACCACCAAGTACTACATCACCATCATCGATGCCCCCGGCCACCGCGACTTCATCAAGAACATGATCACGGGTACATCCCAGGCGGACTGCGCAGTGCTGATCGTGGCGGCGGGCGTGGGCGAGTTCGAGGCGGGCATCTCCAAGAATGGGCAGACGCGGGAGCATGCCCTGCTGGCCTACACGCTGGGTGTGAAGCAGCTCATCGTGGGCGTGAACAAAATGGACTCCACAGAGCCGGCCTACAGCGAGAAGCGCTACGACGAGATCGTCAAGGAAGTCAGCGCCTACATCAAGAAGATCGGCTACAACCCGGCCACCGTGCCCTTTGTGCCCATCTCCGGCTGGCACGGTGACAACATGCTGGAGCCCTCCCCCAACATGCCGTGGTTCAAGGGCTGGAAGGTGGAGCGTAAGGAGGGCAACGCAAGCGGCGTGTCCCTGCTGGAGGCCCTGGACACCATCCTGCCCCCCACGCGCCCCACGGACAAGCCCCTGCGCCTGCCGCTGCAGGACGTGTACAAGATTGGCGGCATTGGCACGGTGCCCGTGGGCCGGGTGGAGACCGGCATCCTGCGGCCGGGCATGGTGGTGACCTTTGCGCCAGTGAACATCACCACTGAGGTGAAGTCAGTGGAGATGCACCACGAGGCTCTGAGCGAAGCTCTGCCCGGCGACAACGTCGGCTTCAATGTGAAGAACGTGTCGGTGAAGGACATCCGGCGGGGCAACGTGTGTGGGGACAGCAAGTCTGACCCGCCGCAGGAGGCTGCTCAGTTCACCTCCCAGGTCATCATCCTGAACCACCCGGGGCAGATTAGCGCCGGCTACTCCCCGGTCATCGACTGCCACACAGCCCACATCGCCTGCAAGTTTGCGGAGCTGAAGGAGAAGATTGACCGGCGCTCTGGCAAGAAGCTGGAGGACAACCCCAAGTCCCTGAAGTCTGGAGACGCGGCCATCGTGGAGATGGTGCCGGGAAAGCCCATGTGTGTGGAGAGCTTCTCCCAGTACCCGCCTCTCGGCCGCTTCGCCGTGCGCGACATGAGGCAGACGGTGGCCGTAGGCGTCATCAAGAACGTGGAGAAGAAGAGCGGCGGCGCCGGCAAGGTCACCAAGTCGGCGCAGAAGGCGCAGAAGGCGGGCAAGTGAAGCGCGGGCGCCCGCGGCGCGACCCTCCCCGGCGGTGCCGCGCTCCGAACCCCGGGCCCGGGCCCCCGCCCCGC