Transcript asmbl_90741

Sequence
Transcript Sequence for observation asmbl_90741 of TGE0056320:
CCAGGTCGCCGCCTTCCCGCGGGGCCCCGCCCCCGGCCCGCCCCAAAGCGGGCTATAAGTTAGCGCCGCTCTCCGCCTCGGCAGTGCCAGCCGCCAGTGGTCGCACTTGGAGGGTCTCGCCGCCAGTGGAAGGAGCCACCGCCCCCGCCCGACCATGGCCGAGGAGCTGGTCTTAGAGAGGTGTGATCTGGAGCTGGAGACCAATGGCCGAGACCACCACACGGCCGACCTGTGCCGGGAGAAGCTGGTGGTGCGACGGGGCCAGCCCTTCTGGCTGACCCTGCACTTTGAGGGCCGCAACTACGAGGCCAGTGTAGACAGTCTCACCTTCAGTGTCGTGACCGGCCCAGCCCCTAGCCAGGAGGCCGGGACCAAGGCCCGTTTTCCACTAAGAGATGCTGTGGAGGAGGGTGACTGGACAGCCACCGTGGTGGACCAGCAAGACTGCACCCTCTCGCTGCAGCTCACCACCCCGGCCAACGCCCCCATCGGCCTGTATCGCCTCAGCCTGGAGGCCTCCACTGGCTACCAGGGATCCAGCTTTGTGCTGGGCCACTTCATTTTGCTCTTCAACGCCTGGTGCCCAGCGGATGCTGTGTACCTGGACTCGGAAGAGGAGCGGCAGGAGTATGTCCTCACCCAGCAGGGCTTTATCTACCAGGGCTCGGCCAAGTTCATCAAGAACATACCTTGGAATTTTGGGCAGTTTGAAGATGGGATCCTAGACATCTGCCTGATCCTTCTAGATGTCAACCCCAAGTTCCTGAAGAACGCCGGCCGTGACTGCTCCCGCCGCAGCAGCCCCGTCTACGTGGGCCGGGTGGTGAGTGGCATGGTCAACTGCAACGATGACCAGGGTGTGCTGCTGGGACGCTGGGACAACAACTACGGGGACGGCGTCAGCCCCATGTCCTGGATCGGCAGCGTGGACATCCTGCGGCGCTGGAAGAACCACGGCTGCCAGCGCGTCAAGTATGGCCAGTGCTGGGTCTTCGCCGCCGTGGCCTGCACAGTGCTGAGGTGCCTGGGCATCCCTACCCGCGTCGTGACCAACTACAACTCGGCCCATGACCAGAACAGCAACCTTCTCATCGAGTACTTCCGCAATGAGTTTGGGGAGATCCAGGGTGACAAGAGCGAGATGATCTGGAACTTCCACTGCTGGGTGGAGTCGTGGATGACCAGGCCGGACCTGCAGCCGGGGTACGAGGGCTGGCAGGCCCTGGACCCAACGCCCCAGGAGAAGAGCGAAGGGACGTACTGCTGTGGCCCAGTTCCAGTTCGTGCCATCAAGGAGGGCGACCTGAGCACCAAGTACGATGCGCCCTTTGTCTTTGCGGAGGTCAATGCCGACGTGGTAGACTGGATCCAGCAGGACGATGGGTCTGTGCACAAATCCATCAACCGTTCCCTGATCGTTGGGCTGAAGATCAGCACTAAGAGCGTGGGCCGAGACGAGCGGGAGGATATCACCCACACCTACAAATACCCAGAGGGGTCCTCAGAGGAGAGGGAGGCCTTCACAAGGGCGAACCACCTGAACAAACTGGCCGAGAAGGAGGAGACAGGGATGGCCATGCGGATCCGTGTGGGCCAGAGCATGAACATGGGCAGTGACTTTGACGTCTTTGCCCACATCACCAACAACACCGCTGAGGAGTACGTCTGCCGCCTCCTGCTCTGTGCCCGCACCGTCAGCTACAATGGGATCTTGGGGCCCGAGTGTGGCACCAAGTACCTGCTCAACCTCAACCTGGAGCCTTTCTCTGAGAAGAGCGTTCCTCTTTGCATCCTCTATGAGAAATACCGTGACTGCCTTACGGAGTCCAACCTCATCAAGGTGCGGGCCCTCCTCGTGGAGCCAGTTATCAACAGCTACCTGCTGGCTGAGAGGGACCTCTACCTGGAGAATCCAGAAATCAAGATCCGGATCCTTGGGGAGCCCAAGCAGAAACGCAAGCTGGTGGCTGAGGTGTCCCTGCAGAACCCGCTCCCTGTGGCCCTGGAAGGCTGCACCTTCACTGTGGAGGGGGCCGGCCTGACTGAGGAGCAGAAGACGGTGGAGATCCCAGACCCCGTGGAGGCAGGGGAGGAAGTTAAGGTGAGAATGGACCTGCTGCCGCTCCACATGGGCCTCCACAAGCTGGTGGTGAACTTCGAGAGCGACAAGCTGAAGGCTGTGAAGGGCTTCCGGAATGTCATCATTGGCCCCGCCTAAGGGACCCCTGCTCCCAGCCTGCTGAGAGCCCCCACCTTGATCCCAATCCTTATCCCAAGCTAGTGAGCAAAATATGCCCCTTCTTGGGCCCCAGACCCCAGGGCAGGGTGGGCAGCCTATGGGGGCTCTCGGAAATGGAATGTGCCCCTGGCCCATCTCAGCCTCCTGAGCCTGTGGGTCCCCACTCACCCCCTTTGCTGTGAGGAATGCTCTGTGCCAGAAACAGTGGGAGCCCTGACCTTGGCTGACTGGGGCTGGGGTGAGAGAGGAAAGACCTACATTCCCTCTCCTGCCCAGATGCCCTTTGGAAAGCCATTGACCACCCACCATATTGTTTGATCTACTTCATAGCTCCTTGGAGCAGGCAAAAAAGGGACAGCATGCCCCTTGGCTGGATCAGGGAATCCAGCTCCCTAGACTGCATCCCGTACCTCTTCCCATGACTGCACCCAGCTCCAGGGGCCCTTGGGACAGCCAGAGCTGGGTGGGGACAGTGATAGGCCCAAGGTCCCCTCCACATCCCAGCAGCCCAAGCTTAATAGCCCTCCCCCTCAACCTCACCATTGTGAAGCACCTACTATGTGCTGGGTGCCTCCCACACTTGCTGGGGCTCACGGGGCCTCCAACCCATTTAATCACCATGGGAAACTGTTGTGGGCGCTGCTTCCAGGATAAGGAGACTGAGGCTTAGAGAGAGGAGGCAGCCCCCTCCACACCAGTGGCCTCGTGGTTATTAGCAAGGCTGGGTAATGTGAAGGCCCAAGAGCAGAGTCTGGGCCTCTGACTCTGAGTCCACTGCTCCATTTATAACCCCAGCCTGACCTGAGACTGTCGGAGAGGCTGTCTGGGGCCTTTATCAAAAAAAGACTCAGCCAAGACAAGGAGGTAGAGAGGGGACTGGGGGACTGGGAGTCAGAGCCCTGGCTGGGTTCAGGTCCCACGTCTGGCCAGGCACTGCCTTCTCCTCTCTGGGCCTTTGTTTCCTTGTTGGTCAGAGGAGTGATTGAACCAGCTCATCTCCAAGGATCCTCTCCACTCCATGTTTGCAATGCTTTTATATGGCCCAGCCTTGTAAATAACCACAAGGTCCACTCCCTGCTCCACGAAGCCTTAAGCCATAGGCCCAGGATATTTCTGAGAGTGAAACCATGACTGTGACCACCTTCTGTCCCCAGCCCTGTCCTGGTTCCTTCCTATGCCCAGGTACCACCCTTCAGACCCCAGTTCTAGGGGAGAAGAGCCCTGGACACCCCTGCTCTACCCATGAGCCTGCCCGCTGCAATGCCTAGACTTCCCAACAGCCTTAGCTGCCAGTGCTGGTCACTAACCAACAAGGTTGGCACCCCAGCTACCCCTTCTTTGCAGGGCTAAGGCCCCCAAACATAGCCCCTGCCCCGGAGGAAGCTTGGGGAACCCATGAGTTGTCAGCTTTGACTTTATCTCCTGCTCTTTCTACATGACTGGGCCTCCCTTGGGCTGGAAGAATTGGGGATTCTCTATTGGAGGTGAGATCACAGCCTCCAGGGCCCCCCAAATCCCAGGGAAGGACTTGGAGAGAATCATGCTGTTGCATTTAGAACTTTCTGCTTTGCACAGGAAAGAGTCACACAATTAATCAACATGTATATTTTCTCTATACATAGAGCTCTATTTCTCTACGGTTTTATAAAAGCCTTGGGTTCCAACCAGGCAGTAGATGTGCTTCTGAACCGCAAGGAGCAAACACTGAAATAAAATAGTTTATTTTTCACACTCAAA