Transcript asmbl_90724

Sequence
Transcript Sequence for observation asmbl_90724 of TGE0057450:
CTGCCATTGCGCCTGCGCAGGGAGCCCAAGGCAAGAGCCGCTAGGCTGCCCTGCCCGAAGGGCTCAACTGTCAGTGAGCCTGCGCAGGAGGCCAATAGGCTGCCAATACTCCTTGGACTCCCCGCCAGGGCCCTGCTGTCAGTGCGCCTGCGCGCGGGTCCGGCGCCGAGGTTCTTGACTGCTGTGCCGGACGCCAGGTGTAGCCATGCAGCGAGCCGATTCCGAGCAGCCCTCCAAGCGTCCCCGTTGCGATGACAGCCCGAGAACCCCCTCAAACACCCCTTCCGCAGAGGCAGACTGGTCCCCGGGCCTGGAACTCCATCCCGACTACAAGACATGGGGTCCGGAGCAGGTGTGCTCCTTCCTCAGGCGCGGTGGCTTTGAAGAGCCGGTGCTGCTGAAGAACATCCGAGAAAATGAAATCACAGGCGCATTACTGCCTTGTCTTGATGAGTCTCGTTTTGAAAATCTTGGAGTAAGTTCCTTGGGGGAGAGGAAGAAGCTGCTTAGTTATATCCAGCGATTGGTTCAAATCCACGTTGATACAATGAAGGTAATTAATGATCCTATCCATGGCCACATTGAGCTCCACCCTCTCCTCGTCCGAATCATTGATACACCTCAATTTCAACGTCTTCGATACATCAAACAGCTGGGAGGTGGTTACTATGTTTTTCCAGGAGCTTCACACAATCGATTTGAGCATAGTCTAGGGGTGGGGTATCTAGCAGGATGTCTAGTTCACGCACTGGGTGAAAAACAACCAGAGCTGCAGATAAGTGAACGAGATGTTCTCTGTGTTCAGATTGCTGGACTTTGTCATGATCTCGGTCATGGGCCATTTTCTCACATGTTTGATGGACGATTTATTCCACTTGCTCGCCCGGAGGTGAAATGGACGCATGAACAAGGCTCAGTTATGATGTTTGAGCACCTTATTAATTCTAATGGAATTAAGCCTGTCATGGAACAATATGGTCTCATCCCTGAAGAAGATATTTGCTTTATAAAGGAACAAATTGTAGGACCACTTGAATCACCTGTCGAAGATTCATTGTGGCCATATAAAGGGCGTCCTGAAAACAAAAGCTTCCTTTATGAGATAGTATCTAATAAAAGAAATGGCATTGATGTGGACAAATGGGATTATTTTGCCAGGGACTGCCATCATCTTGGAATCCAAAATAATTTTGATTACAAGCGCTTTATTAAGTTTGCCCGTGTCTGTGAAGTAGACAATGAGTTGCGTATTTGTGCTAGAGATAAGGAAGTTGGAAATCTGTATGACATGTTCCACACTCGCAACTCTTTACACCGTAGAGCTTATCAACACAAAGTTGGCAACATTATTGATACAATGATTACAGATGCTTTCCTCAAAGCAGATGACTACATAGAGATTACAGGTGCTGGAGGAAAAAAGTATCGCATTTCTACAGCAATTGACGACATGGAAGCCTATACTAAGCTGACAGATAACATTTTTCTGGAGATTTTATACTCTACTGATCCCAAATTGAAAGACGCACGAGAGATTTTAAAACAAATTGAATACCGTAATCTATTCAAGTATGTGGGTGAGACGCAGCCAACAGGACAAATAAAGATTAAAAGGGAGGACTATGAATCTCTTCCAAAAGAGGTTGCCAGTGCTAAACCCAAAGTATTGCTAGACGTGAAACTGAAGGCTGAAGATTTTATAGTGGATGTTTCACAACTTCTGCCAGAGAAATTTGCAGAGCAGCTGATTCGAGTATATTGTAAGAAGGTGGACAGAAAGAGTTTGTATGCCGCAAGACAATATTTTGTTCAGTGGTGTGCAGACAGAAATTTCACCAAGCCGCAGGATGGCGATGTTATAGCCCCACTCATAACACCTCAAAAAAAGGAATGGAACGACAGTACTTCAGTCCAAAATCCAACTCGCCTCCGAGAAGCATCCAAAAGCAGAGTCCAGCTTTTTAAAGATGACCCAATGTGAATGTCTGTAGTCAGTTGTTTACAAACTCCCTCTCCTGCACAATTCATTTAGAGGCTTCAATCATAGAATTCTGCAAATTAATGACAACTCATGCTTTAATTTTGTATTTTGAATGTACACGCATGCTGAAGCTAAGTAACTTTTAATCAAAGAAATAAGATGGTATTAGGCAAATCTTACTATACTATGAAAAGCATTACCTTGCCTATTTTTAATATTATTAAAGCCTTTCTCCTTCAGTAGTCTATTTTCTTAGAATAACAACTCTTTTATCTATTCTGAACTCTATTTTTTTTCTTTTTTAAGAGACAAGGTTTTGCTCTGTTGCCCAGCTTGGACTCGAACTTTCCTGGGCTCAAGCGACCCTCCTGCCTCAGCCCCCCAAGTAGCTGGGACTAAAGTCATGTGCCACCACACCCAGCTTACTCTGAACTTTTATGACAGATGATTGTTTTTTGTTTTTAATGTAGAAATGAGACAAGGGTACAAATTGGAACTAGAAATTGACATTGTCATTGACAAACATGGCTAAAAACAAAACATCAAATCCTGCCCCCGTGAAGAGTTCCCTGTCACCTCAAGTTTGAGGATAGTCCTCTAAGAGTGACCTAAGCATAAGTGAAAGACACCTCCCCTCACCCTTCTAGCCCCCTACAAGGTGCCAGGTTGGGGTAAAGAGTTGGAGATGATGGCCAGGAGTGGCCTCCAACACGCTGGTGAGAGGCCTGATTAGGTTTTGGGGAAGATCTGAGAGCTCTGGCCTCTTCGTGAGTGGAACATAAAGCCGCCTCTTGTTGGGAGATCCTACCCCAGTGACAGAGGAATCCCCCAAACTAGGCTGTGCCCTGGCTCCGTGGCGGCTCCAGACCCGGGTAGTGCCTTTGTCCCCTGAATACTCACTCCCCCGGTCCAGAGGGCCTTCCCACTGCCCAGCCTGGAGAAGGCCTCCCCTGACCTGCTCTCTCAGTATCCTGGAGAGCTGGCCAGAGGCCATCACAGGCATCATCCTCAGAGCTCCTCAGACCTGGGACTTTGTTTTTGCTGGTTCAGTGCATTTTGTGTATTTAAGAGCAAACACTAGCCAGGCGTGGCGGCGTGTGCCTGTAGTCCCAGCTACTTGGGAGGCTGAGGCAGGAGGAT