Transcript asmbl_90574

Sequence
Transcript Sequence for observation asmbl_90574 of TGE0059694:
CCGCTCAGTGTGAGGTGGTTTCTGCGGGTGAGGCTGGCGCCCGTACCATGAGCGAGGCGGACGGGCTGCGACAGCGCCGGCCCCTGCGGCCGCAGGTCGTCACAGACGATGATGGCCAGGCCCCGGAGGCTAAGGACGGCAGCTCCTTTAGCGGCAGAGTTTTCCGAGTGACCTTCTTGATGCTGGCTGTTTCTCTCACCGTTCCCCTGCTTGGAGCCATGATGCTGCTGGAATCTCCTATAGATCCACAGCCTCTCAGCTTCAAAGAACCCCCGCTCTTGCTTGGTGTTCTGCATCCAAATACGAAGCTGCGACAGGCAGAAAGGCTGTTTGAAAATCAACTTGTTGGACCGGAGTCCATAGCACATATTGGGGATGTGATGTTTACTGGGACAGCAGATGGCCGGGTCGTAAAACTTGAAAATGGTGAAATAGAGACCATTGCCCGGTTTGGTTCGGGCCCTTGCAAAACCCGAGATGATGAGCCTGTGTGTGGGAGACCCCTGGGTATCCGTGCAGGGCCCAATGGGACTCTCTTTGTGGCCGATGCATACAAGGGACTATTTGAAGTAAATCCCTGGAAACGTGAAGTGAAACTGCTGCTGTCCTCCGAGACACCCATTGAGGGGAAGAACATGTCCTTTGTGAATGATCTTACAGTCACTCAGGATGGGAGGAAGATTTATTTCACCGATTCTAGCAGCAAATGGCAAAGACGAGACTACCTGCTTCTGGTGATGGAGGGCACAGATGACGGGCGCCTGCTGGAGTATGATACTGTGACCAGGGAAGTAAAAGTTTTATTGGACCAGCTGCGGTTCCCGAATGGAGTCCAGCTGTCTCCTGCAGAAGACTTTGTCCTGGTGGCAGAAACAACCATGGCCAGGATACGAAGAGTCTACGTTTCTGGCCTGATGAAGGGCGGGGCTGATCTGTTTGTGGAGAACATGCCTGGATTTCCAGACAACATCCGGCCCAGCAGCTCTGGGGGGTACTGGGTGGGCATGTCGACCATCCGCCCTAACCCTGGGTTTTCCATGCTGGATTTCTTATCTGAGAGACCCTGGATTAAAAGGATGATTTTTAAGGTAACTGTGAAAACTGTTATTCCAAGAAAGAAAATGGAAATGAATTGAATCATATTTTTTTGACCCTTATAGCTTAAAAATCTAGTTCTGCTTGTAGTATTTGGCTCTGAATGACACTTAGAAACACATTTCATTCTTCATCCTGAAATGCAGATTTAAACATTTGGACCCTTTGGTTCTTATGGTTTTCCTTTTTCTGGGTGTTTTTATTGTCACCCTCACCATCGTGGCTTTGGGCATCTGCCTGCCTGTCAGTCTCTGGTTCCCTGTTTCTGGGTGTTTTGATTGCCACCCTCACCATCGTGGCTCTGGGCATCTGCGTGCCTGTCAGTCTTGCTCCTCCATCTGCCATGGCTTTGCCAGGCCTTCTGTGCTCTCCACCCCCCTCTCTGCCTCCTCAGGGAAAGAGTCGGCAGGTGCCCTTTCCTCCCCTCCCTGCAGGTGTGGCCACCCCTGTAACCTAGTCACCACAGCTGCCATCCCGCCTGCTCCCTGCTGCCTTCTTGCAGCCTCACTGCCAGGCACTCTTCTCTATGGAGTTCTGCCCTTTGACCTCTTACCACACCCAAATCTTTCCCTTTTTAAAAAAAAGTCACCCACCCCCACCAATGGCCAGCCATGGCCCCTTCAACACAACAGCCCCTTCAACACAGCCTTTAAATCTTGCCATTTTCCCAGTGGCTTCCATGAAGCACCCCACATAATAACTCAGCACGTTTACACTGTGGAGGGGTCACTTGCTGATGTGGGCACTTGTGTAATACAGAGATCTGCTTTTCCAGCAAGCTCCGTGTCACAGGCTGAATAGGTATTTTAAATTGATACTGAATATTTGAACCGATATGGAAATACTAGCTTATGGTCCTGGGGCTGACAGGCAGCAGTTGCTGAGTCCTGTTGCTGGGCTGTGTGTCTGGACCCCTCCTGGGGGCTGCGTGCACATTCTCAGTTAGACTGGCTCACGGCCTTCAGTGATGTGAGTTCTGTGGGTCGCTGTGTGGGAAGTCCTAATCTGTTGAGAAATCTGTCCTTCTCTTTGCCTTATTGGCTCCAGAGACAGCATCTGTTCCTGCTGGGACCTAGGGGGAGGCAAAATGGCAGGTGGGCTAGCACAGGGGTTTTGGAGGCTGCCAGACCAGCTGTGGGATCCTGGGCCGGGGACTTGGACTCGCTGCCTCAGGTGCTCTGTCTGTAAAGTGGAAAGAATAATAGTGCCTCATCAGGTGCTGGGAACATTTAGTGAGAATCTGCACATAGTGCCCTTAGCGTAGGGTAGTATGAGTGGTGGTTGTGTCTCTTCCCCTGAATAGAATGTGCATACCATCAGAGCAGGTGTTTTTCTGTTTAGTTCATGCATAGTTCATTTGTCATCCTCCACACCTGCAACAGTGCCTGGCACATGTAGGTGCGAGGACGTACCGTTGATTGAGGGCACAGTTAGGGAGGGGGCTGCAAGCATGAGGGAACATGGAGTCTTCCTGCAGCTGGGTGAGGAGGGGTGAGAGGGAGGACCACAGCCCCATGGACTTGGAAAGAAGGTTCAGTTTTATTCAAAATGTAATCCAAGTCATTGAAGATTTTTTTGTTTTTTGTTTTTGAGAC