Transcript asmbl_90547

Sequence
Transcript Sequence for observation asmbl_90547 of TGE0059691:
GAACCAGGGCAAGAAGGCTGAGGGTGCCCAGAACCAGGGGCAAAAAGGCCGAGGGAGCCCAGAACCAGGGCCAAAAAGGAGAGGGAGCCCAGAATCAGGGTAAAAAGACAGAAGGGGCTCAGGGCAAAAAGGCAGAAAGGAGTCCCAACCAAGGCAAAAAAGGAGAGGGAGCTCCCATCCAGGGCAAAAAGGCAGATTCGGTTGCTAATCAGGGCACAAAGGTAGAGGGTATTACAAACCAGGGGAAAAAAGCAGAAGGGTCCCCCAGTGAAGGCAAAAAGGCAGAAGGGTCCCCCAACCAAGGCAAAAAGGCAGACGCAGCTGCCAATCAGGGTAAAAAGACAGAGTCAGCTTCTGTCCAGGGCAGAAATACAGATGTGGCCCAGAGCCCAGAGGCACCAAAGCAAGAGGCTCCTGCCAAGAAGAAGTCTGGTTCAAAGAAAAAAGGTGAGCCTGGGCCCCCAGATGCCGACGGCCCTCTCTACCTCCCCTACAAGACGCTGGTCTCCACGGTTGGGAGCATGGTGTTCAACGAGGGCGAGGCCCAGCGGCTCATCGAGATCCTGTCTGAGAAGGCTGGCATCATTCAGGACACCTGGCACAAGGCCACTCAGAAGGGTGACCCTGTGGCGATTCTGAAACGCCAGCTGGAAGAGAAGGAAAAACTGCTGGCCACAGAACAGGAAGATGCGGCTGTCGCCAAGAGCAAACTGAGGGAGCTCAACAAGGAGATGGCAGCAGAAAAGGCCAAAGCAGCAGCCGGGGAGGCCAAAGTGAAAAAGCAGCTGGTGGCCCGGGAGCAGGAGATCACGGCTGTGCAGGCACGCATGCAGGCCAGCTACCGGGAGCACGTGAAGGAGGTGCAGCAGCTGCAGGGCAAGATCCGGACTCTTCAGGAGCAGCTGGAGAATGGCCCCAACACGCAGCTGGCCCGCCTGCAGCAGGAGAACTCCATCCTGCGGGATGCCTTGAACCAGGCCACGAGCCAGGTGGAGAGCAAGCAGAACGCAGAGCTGGCCAAGCTTCGGCAGGAGCTCAGCAAGGTCAGCAAAGAGCTGGTGGAGAAGTCAGAGGCTGTGCGGCAAGATGAGCAGCAGCGGAAAGCTCTGGAAGCCAAGGCAGCTGCCTTCGAGAAGCAGGTCCTGCAGCTGCAGGCGTCCCACAGGGAGAGTGAGGAGGCCCTGCAGAAGCGCCTGGACGAGGTCAGCCGGGAGCTGTGCCACACGCAGAGCAGCCACGCCAGCCTCCGGGCGGATGCCGAGAAGGCCCAGGAGCAACAGCAGCAGATGGCCGAGCTGCACAGCAAGTTACAGTCCTCCGAGGCGGAGGTGCGCAGCAAATGCGAGGAGCTGAGTGGCCTCCACGGGCAGCTCCAGGAGGCCAGGGCGGAGAACTCCCAGCTCACAGAGAGAATCCGTTCCATTGAGGCCCTGCTGGAGGCGGGCCAGGCGCGGGATGCCCAGGACGTCCAGGCCAGCCAGGCGGAGGCTGACCAGCAGCAGACTCGCCTCAAGGAGCTGGAGTCCCAGGTGTCGGGTCTGGAGAAGGAGGCCATCGAGCTCAGGGAGGCCGTCGAGCAGCAGAAAGTGAAGAACAATGACCTCCGGGAGAAGAACTGGAAGGCCATGGAGGCACTGGCCACGGCCGAGCAGGCCTGCAAGGAGAAGCTGCTCTCCCTGACCCAGGCCAAGGAGGAATCGGAGAAGCAGCTCTGTCTGATTGAGGCGCAGACCATGGAGGCCCTGCTGGCTCTGCTCCCAGAACTCTCTGTCTTGGCACAACAGAATTACACCGAGTGGCTGCAGGATCTCAAAGAGAAAGGCCCCACGCTGCTGAAGCACCCGCCAGCTCCCGCGGAGCCCTCCTCGGACCTGGCCTCCAAGTTGAGGGAGGCCGAGGAGACGCAGAGCACACTGCAGGCCGAGTGTGACCAGTACCGCAGCATCCTGGCGGAGACGGAGGGCATGCTCAGAGACCTGCAGAAGAGCGTGGAGGAGGAGGAGCAGGTGTGGAGGGCCAAGGTGGGCGCCGCAGAGGAGGAGCTCCAGAAGTCCCGGGTCACAGTGAAGCATCTCGAAGAGATTGTAGAGAAGCTAAAAGGAGAACTTGAAAGTTCGGACCAGGTGAGGGAGCACACGTCGCATTTGGAGGCAGAGCTGGAAAAGCACATGGCGGCCGCCAGCGCCGAGTGCCAGAACTACGCCAAGGAGGTGGCAGGGCTGAGGCAACTTCTCCTAGAATCTCAATCTCAGCTCGATGCCGCCAAGAGCGAAGCCCAGAAACAGAGCGATGAGCTTGCCCTGGTCAGGCAGCAGTTGAGTGAAATGAAGAGCCACGTAGAGGATGGTGACATAGCTGGGGCCCCAGCTTCCTCCCCAGAGGCGCCCCCAGCCGAGCAGGACCCCGTTCAGCTGAAGACGCAGCTGGAGTGGACAGAAGCCATCCTGGAGGATGAGCAGACACAGCGGCAGAAGCTCACGGCCGAGTTTGAGGAGGCTCAGACCTCGGCATGTCGGTTACAAGAAGAATTGGAGAAGCTCCGCACAGCCGGCCCCCTAGAGTCTTCAGAAACAGAGGAGGCCTCACAGCTGAAGGAGAGACTAGAAAAAGAGAAGAAGTTAACAAGTGACCTGGGGCGCGCCGCCACGAGACTGCAGGAGCTTCTGAAGACGACCCAGGAGCAGCTGGCAAGGGAGAAGGACACGGTGAAGAAGCTGCAGGAACAGCTGGAAAAGGCAGAGGACGGCAGCAGCTCAAAGGAGGGCACCTCTGTCTGAGTTTCCTCTTTGGAAAAAGAAGTTACTGTTCAACTTACCAAAATGCCTTACACATTCCTTACAAATAAACCAACCAACCTACACAGCGTTATCCAGGCCCAACTTCCGGTAGCTCCGAGAGAAGCCATGAGAGACAAGTCTCTTAGAGCCACAGAAGTAGACCTTCCAGAGCCCCAGTTTGTAAATGAACCTGTGTCACATTTGATAAACACTATCCTGGGCGCAGCCCCGGGCCACCGCCGAGTGACGCCAAAGCCCTGGTTGACTCTGACAGCCCCGTGGGTGTGTGGGAGGCCGGGCGCTCTGGGGTCTGTCTGTCAGTGCAATCGTTTAGTGTTTTTTCAGTGGGGCGGGGCGGGAAGCGGGTGGGACCGGGCAGCCAGTTCTCAAAGGCTGTGGGGCCGACTGGAGGCCACAGCCCCTCACCCCTAGACGTTGCCAACCAGAACTGACGTGTGACCTCCTGGGTGTTGATGCCATTAAAACCAACGTTGGTGCCCGGTG