Transcript asmbl_90546

Sequence
Transcript Sequence for observation asmbl_90546 of TGE0059690:
GGCGGCGATCCCGGCGGAGGGGGCCGTTCGCCAGCTCTGAGGCAGAAAGTGCCACGACTCCACACGCGCGCACGCAGCCAGCGAGCGGCCGGAGCGGACGGCAGACGGGGCGGGCGGCGTCAGGGTCGCAGCGTCTACAGCTGCTCGGGGGCGGTTTCTTGGCGGAGGCTTGGCCGGCTCCTCTCTCCCGGCTCCGCGGCGGCTGCGAAGGCGGCGGCTCCTGCCCTCTCGCTTTCCCTCTCGCGTCTCTGGCTGCAGGTGAAAGGAAAGCAAGCCAGGATGGATATTTACGACACTCAAACCTTGGGGGTTGTGGTCTTTGGAGGATTCATGGTTGTTTCTGCCATTGGCATCTTCCTGGTGTCGACTTTCTCCATGAAGGAAACGTCATATGAAGAAGCCCTAGCCAACCAGCGCAAGGAGATGGCGAAAACTCACCACCAGAAAGTCGAGAAGAAAAAGAAGGAGAAAACAGTGGAGAAGAAAGGAAAGACCAAGAAAAAGGAAGAGAAACCTAATGGGAAGATACCTGATCATGATCCAGCCCCCAATGTGACTGTCCTCCTTCGAGAACCAGTGCGGGCTCCTGCTGTGGCTGTGGCTCCAACCCCAGTGCAGCCCCCCATTATCGTTGCTCCTGTCGCCACAGTTCCAGCCATGCCCCAGGAGAAGCTGGCCTCCTCCCCCAAGGACAAAAAGAAGAAGGAGAAAAAAGTGGCAAAAGTGGAACCAGCTGTCAGCTCTGTAGTGAATTCCATCCAGGTTCTCACTTCGAAGGCTGCCATCTTGGAAACTGCTCCCAAGGAGGTGCCGATGGTGGTGGTGCCCCCAGTGGGTGCCAAGGGCAACACACCAGCCACTGGCACTACTCAGGGCAAAAAGGCGGAGGGGACTCAGAATCAAAGCAAAAAGGCTGAAGGAGCCCCAAACCAGGGCAGAAAGGCAGAGGGAACCCCAAACCAGGGCAAAAAGGCGGAGGGGGCCCAGAACCAGGGTAAAAAGGTAGATACAACCCCAAACCAGGGGAAAAAGGTGGAGGGGGCCCCAACCCAGGGCAGAAAGGCCGAGGGGGCTCAGAACCAGGGCAAAAAGGCCGAGGGAGCCCAGAACCAGGGCCAAAAAGGAGAGGGAGCCCAGAATCAGGGTAAAAAGACAGAAGGGGCTCAGGGCAAAAAGGCAGAAAGGAGTCCCAACCAAGGCAAAAAAGGAGAGGGAGCTCCCATCCAGGGCAAAAAGGCAGATTCGGTTGCTAATCAGGGCACAAAGGTAGAGGGTATTACAAACCAGGGGAAAAAAGCAGAAGGGTCCCCCAGTGAAGGCAAAAAGGCAGAAGGGTCCCCCAACCAAGGCAAAAAGGCAGACGCAGCTGCCAATCAGGGTAAAAAGACAGAGTCAGCTTCTGTCCAGGGCAGAAATACAGATGTGGCCCAGAGCCCAGAGGCACCAAAGCAAGAGGCTCCTGCCAAGAAGAAGTCTGGTTCAAAGAAAAAAGGTGAGCCTGGGCCCCCAGATGCCGACGGCCCTCTCTACCTCCCCTACAAGACGCTGGTCTCCACGGTTGGGAGCATGGTGTTCAACGAGGGCGAGGCCCAGCGGCTCATCGAGATCCTGTCTGAGAAGGCTGGCATCATTCAGGACACCTGGCACAAGGCCACTCAGAAGGGTGACCCTGTGGCGATTCTGAAACGCCAGCTGGAAGAGAAGGAAAAACTGCTGGCCACAGAACAGGAAGATGCGGCTGTCGCCAAGAGCAAACTGAGGGAGCTCAACAAGGAGATGGCAGCAGAAAAGGCCAAAGCAGCAGCCGGGGAGGCCAAAGTGAAAAAGCAGCTGGTGGCCCGGGAGCAGGAGATCACGGCTGTGCAGGCACGCATGCAGGCCAGCTACCGGGAGCACGTGAAGGAGGTGCAGCAGCTGCAGGGCAAGATCCGGACTCTTCAGGAGCAGCTGGAGAATGGCCCCAACACGCAGCTGGCCCGCCTGCAGCAGGAGAACTCCATCCTGCGGGATGCCTTGAACCAGGCCACGAGCCAGGTGGAGAGCAAGCAGAACGCAGAGCTGGCCAAGCTTCGGCAGGAGCTCAGCAAGGTCAGCAAAGAGCTGGTGGAGAAGTCAGAGGCTGTGCGGCAAGATGAGCAGCAGCGGAAAGCTCTGGAAGCCAAGGCAGCTGCCTTCGAGAAGCAGGTCCTGCAGCTGCAGGCGTCCCACAGGGAGAGTGAGGAGGCCCTGCAGAAGCGCCTGGACGAGGTCAGCCGGGAGCTGTGCCACACGCAGAGCAGCCACGCCAGCCTCCGGGCGGATGCCGAGAAGGCCCAGGAGCAACAGCAGCAGATGGCCGAGCTGCACAGCAAGTTACAGTCCTCCGAGGCGGAGGTGCGCAGCAAATGCGAGGAGCTGAGTGGCCTCCACGGGCAGCTCCAGGAGGCCAGGGCGGAGAACTCCCAGCTCACAGAGAGAATCCGTTCCATTGAGGCCCTGCTGGAGGCGGGCCAGGCGCGGGATGCCCAGGACGTCCAGGCCAGCCAGGCGGAGGCTGACCAGCAGCAGACTCGCCTCAAGGAGCTGGAGTCCCAGGTGTCGGGTCTGGAGAAGGAGGCCATCGAGCTCAGGGAGGCCGTCGAGCAGCAGAAAGTGAAGAACAATGACCTCCGGGAGAAGAACTGGAAGGCCATGGAGGCACTGGCCACGGCCGAGCAGGCCTGCAAGGAGAAGCTGCTCTCCCTGACCCAGGCCAAGGAGGAATCGGAGAAGCAGCTCTGTCTGATTGAGGCGCAGACCATGGAGGCCCTGCTGGCTCTGCTCCCAGAACTCTCTGTCTTGGCACAACAGAATTACACCGAGTGGCTGCAGGATCTCAAAGAGAAAGGCCCCACGCTGCTGAAGCACCCGCCAGCTCCCGCGGAGCCCTCCTCGGACCTGGCCTCCAAGTTGAGGGAGGCCGAGGAGACGCAGAGCACACTGCAGGCCGAGTGTGACCAGTACCGCAGCATCCTGGCGGAGACGGAGGGCATGCTCAGAGACCTGCAGAAGAGCGTGGAGGAGGAGGAGCAGGTGTGGAGGGCCAAGGTGGGCGCCGCAGAGGAGGAGCTCCAGAAGTCCCGGGTCACAGTGAAGCATCTCGAAGAGATTGTAGAGAAGCTAAAAGGAGAACTTGAAAGTTCGGACCAGGTGAGGGAGCACACGTCGCATTTGGAGGCAGAGCTGGAAAAGCACATGGCGGCCGCCAGCGCCGAGTGCCAGAACTACGCCAAGGAGGTGGCAGGGCTGAGGCAACTTCTCCTAGAATCTCAATCTCAGCTCGATGCCGCCAAGAGCGAAGCCCAGAAACAGAGCGATGAGCTTGCCCTGGTCAGGCAGCAGTTGAGTGAAATGAAGAGCCACGTAGAGGATGGTGACATAGCTGGGGCCCCAGCTTCCTCCCCAGAGGCGCCCCCAGCCGAGCAGGACCCCGTTCAGCTGAAGACGCAGCTGGAGTGGACAGAAGCCATCCTGGAGGATGAGCAGACACAGCGGCAGAAGCTCACGGCCGAGTTTGAGGAGGCTCAGACCTCGGCATGTCGGTTACAAGAAGAATTGGAGAAGCTCCGCACAGCCGGCCCCCTAGAGTCTTCAGAAACAGAGGAGGCCTCACAGCTGAAGGAGAGACTAGAAAAAGAGAAGAAGTTAACAAGTGACCTGGGGCGCGCCGCCACGAGACTGCAGGAGCTTCTGAAGACGACCCAGGAGCAGCTGGCAAGGGAGAAGGACACGGTGAAGAAGCTGCAGGAACAGCTGGAAAAGGCAGAGGACGGCAGCAGCTCAAAGGAGGGCACCTCTGTCTGAGTTTCCTCTTTGGAAAAAGAAGTTACTGTTCAACTTACCAAAATGCCTTACACATTCCTTACAAATAAACCAACCAACCTACACAGCGTTATCCAGGCCCAACTTCCGGTAGCTCCGAGAGAAGCCATGAGAGACAAGTCTCTTAGAGCCACAGAAGTAGACCTTCCAGAGCCCCAGTTTGTAAATGAACCTGTGTCACATTTGATAAACACTATCCTGGGCGCAGCCCCGGGCCACCGCCGAGTGACGCCAAAGCCCTGGTTGACTCTGACAGCCCCGTGGGTGTGTGGGAGGCCGGGCGCTCTGGGGTCTGTCTGTCAGTGCAATCGTTTAGTGTTTTTTCAGTGGGGCGGGGCGGGAAGCGGGTGGGACCGGGCAGCCAGTTCTCAAAGGCTGTGGGGCCGACTGGAGGCCACAGCCCCTCACCCCTAGACGTTGCCAACCAGAACTGACGTGTGACCTCCTGGGTGTTGATGCCATTAAAACCAACGTTGGTGCCCGGTG