Transcript asmbl_90545

Sequence
Transcript Sequence for observation asmbl_90545 of TGE0059689:
AAAGAAGCTTCCGGTTCTGAGGTCCTGGAGGTGCCATTTCCCTCTCTGTTGAAGCAAAGGCCGGGGCAGACCTCCTAGTAGGTGAAAGGAAAGCAAGCCAGGATGGATATTTACGACACTCAAACCTTGGGGGTTGTGGTCTTTGGAGGATTCATGGTTGTTTCTGCCATTGGCATCTTCCTGGTGTCGACTTTCTCCATGAAGGAAACGTCATATGAAGAAGCCCTAGCCAACCAGCGCAAGGAGATGGCGAAAACTCACCACCAGAAAGTCGAGAAGAAAAAGAAGGAGAAAACAGTGGAGAAGAAAGGAAAGACCAAGAAAAAGGAAGAGAAACCTAATGGGAAGATACCTGATCATGATCCAGCCCCCAATGTGACTGTCCTCCTTCGAGAACCAGTGCGGGCTCCTGCTGTGGCTGTGGCTCCAACCCCAGTGCAGCCCCCCATTATCGTTGCTCCTGTCGCCACAGTTCCAGCCATGCCCCAGGAGAAGCTGGCCTCCTCCCCCAAGGACAAAAAGAAGAAGGAGAAAAAAGTGGCAAAAGTGGAACCAGCTGTCAGCTCTGTAGTGAATTCCATCCAGGTTCTCACTTCGAAGGCTGCCATCTTGGAAACTGCTCCCAAGGAGGTGCCGATGGTGGTGGTGCCCCCAGTGGGTGCCAAGGGCAACACACCAGCCACTGGCACTACTCAGGGCAAAAAGGCGGAGGGGACTCAGAATCAAAGCAAAAAGGCTGAAGGAGCCCCAAACCAGGGCAGAAAGGCAGAGGGAACCCCAAACCAGGGCAAAAAGGCGGAGGGGGCCCAGAACCAGGGTAAAAAGGTAGATACAACCCCAAACCAGGGGAAAAAGGTGGAGGGGGCCCCAACCCAGGGCAGAAAGGCCGAGGGGGCTCAGAACCAGGGCAAAAAGGCCGAGGGAGCCCAGAACCAGGGCCAAAAAGGAGAGGGAGCCCAGAATCAGGGTAAAAAGACAGAAGGGGCTCAGGGCAAAAAGGCAGAAAGGAGTCCCAACCAAGGCAAAAAAGGAGAGGGAGCTCCCATCCAGGGCAAAAAGGCAGATTCGGTTGCTAATCAGGGCACAAAGGTAGAGGGTATTACAAACCAGGGGAAAAAAGCAGAAGGGTCCCCCAGTGAAGGCAAAAAGGCAGAAGGGTCCCCCAACCAAGGCAAAAAGGCAGACGCAGCTGCCAATCAGGGTAAAAAGACAGAGTCAGCTTCTGTCCAGGGCAGAAATACAGATGTGGCCCAGAGCCCAGAGGCACCAAAGCAAGAGGCTCCTGCCAAGAAGAAGTCTGGTTCAAAGAAAAAAGGTGAGCCTGGGCCCCCAGATGCCGACGGCCCTCTCTACCTCCCCTACAAGACGCTGGTCTCCACGGTTGGGAGCATGGTGTTCAACGAGGGCGAGGCCCAGCGGCTCATCGAGATCCTGTCTGAGAAGGCTGGCATCATTCAGGACACCTGGCACAAGGCCACTCAGAAGGGTGACCCTGTGGCGATTCTGAAACGCCAGCTGGAAGAGAAGGAAAAACTGCTGGCCACAGAACAGGAAGATGCGGCTGTCGCCAAGAGCAAACTGAGGGAGCTCAACAAGGAGATGGCAGCAGAAAAGGCCAAAGCAGCAGCCGGGGAGGCCAAAGTGAAAAAGCAGCTGGTGGCCCGGGAGCAGGAGATCACGGCTGTGCAGGCACGCATGCAGGCCAGCTACCGGGAGCACGTGAAGGAGGTGCAGCAGCTGCAGGGCAAGATCCGGACTCTTCAGGAGCAGCTGGAGAATGGCCCCAACACGCAGCTGGCCCGCCTGCAGCAGGAGAACTCCATCCTGCGGGATGCCTTGAACCAGGCCACGAGCCAGGTGGAGAGCAAGCAGAACGCAGAGCTGGCCAAGCTTCGGCAGGAGCTCAGCAAGGTCAGCAAAGAGCTGGTGGAGAAGTCAGAGGCTGTGCGGCAAGATGAGCAGCAGCGGAAAGCTCTGGAAGCCAAGGCAGCTGCCTTCGAGAAGCAGGTCCTGCAGCTGCAGGCGTCCCACAGGGAGAGTGAGGAGGCCCTGCAGAAGCGCCTGGACGAGGTCAGCCGGGAGCTGTGCCACACGCAGAGCAGCCACGCCAGCCTCCGGGCGGATGCCGAGAAGGCCCAGGAGCAACAGCAGCAGATGGCCGAGCTGCACAGCAAGTTACAGTCCTCCGAGGCGGAGGTGCGCAGCAAATGCGAGGAGCTGAGTGGCCTCCACGGGCAGCTCCAGGAGGCCAGGGCGGAGAACTCCCAGCTCACAGAGAGAATCCGTTCCATTGAGGCCCTGCTGGAGGCGGGCCAGGCGCGGGATGCCCAGGACGTCCAGGCCAGCCAGGCGGAGGCTGACCAGCAGCAGACTCGCCTCAAGGAGCTGGAGTCCCAGGTGTCGGGTCTGGAGAAGGAGGCCATCGAGCTCAGGGAGGCCGTCGAGCAGCAGAAAGTGAAGAACAATGACCTCCGGGAGAAGAACTGGAAGGCCATGGAGGCACTGGCCACGGCCGAGCAGGCCTGCAAGGAGAAGCTGCTCTCCCTGACCCAGGCCAAGGAGGAATCGGAGAAGCAGCTCTGTCTGATTGAGGCGCAGACCATGGAGGCCCTGCTGGCTCTGCTCCCAGAACTCTCTGTCTTGGCACAACAGAATTACACCGAGTGGCTGCAGGATCTCAAAGAGAAAGGCCCCACGCTGCTGAAGCACCCGCCAGCTCCCGCGGAGCCCTCCTCGGACCTGGCCTCCAAGTTGAGGGAGGCCGAGGAGACGCAGAGCACACTGCAGGCCGAGTGTGACCAGTACCGCAGCATCCTGGCGGAGACGGAGGGCATGCTCAGAGACCTGCAGAAGAGCGTGGAGGAGGAGGAGCAGGTGTGGAGGGCCAAGGTGGGCGCCGCAGAGGAGGAGCTCCAGAAGTCCCGGGTCACAGTGAAGCATCTCGAAGAGATTGTAGAGAAGCTAAAAGGAGAACTTGAAAGTTCGGACCAGGTGAGGGAGCACACGTCGCATTTGGAGGCAGAGCTGGAAAAGCACATGGCGGCCGCCAGCGCCGAGTGCCAGAACTACGCCAAGGAGGTGGCAGGGCTGAGGCAACTTCTCCTAGAATCTCAATCTCAGCTCGATGCCGCCAAGAGCGAAGCCCAGAAACAGAGCGATGAGCTTGCCCTGGTCAGGCAGCAGTTGAGTGAAATGAAGAGCCACGTAGAGGATGGTGACATAGCTGGGGCCCCAGCTTCCTCCCCAGAGGCGCCCCCAGCCGAGCAGGACCCCGTTCAGCTGAAGACGCAGCTGGAGTGGACAGAAGCCATCCTGGAGGATGAGCAGACACAGCGGCAGAAGCTCACGGCCGAGTTTGAGGAGGCTCAGACCTCGGCATGTCGGTTACAAGAAGAATTGGAGAAGCTCCGCACAGCCGGCCCCCTAGAGTCTTCAGAAACAGAGGAGGCCTCACAGCTGAAGGAGAGACTAGAAAAAGAGAAGAAGTTAACAAGTGACCTGGGGCGCGCCGCCACGAGACTGCAGGAGCTTCTGAAGACGACCCAGGAGCAGCTGGCAAGGGAGAAGGACACGGTGAAGAAGCTGCAGGAACAGCTGGAAAAGGCAGAGGACGGCAGCAGCTCAAAGGAGGGCACCTCTGTCTGAGTTTCCTCTTTGGAAAAAGAAGTTACTGTTCAACTTACCAAAATGCCTTACACATTCCTTACAAATAAACCAACCAACCTACACAGCGTTATCCAGGCCCAACTTCCGGTAGCTCCGAGAGAAGCCATGAGAGACAAGTCTCTTAGAGCCACAGAAGTAGACCTTCCAGAGCCCCAGTTTGTAAATGAACCTGTGTCACATTTGATAAACACTATCCTGGGCGCAGCCCCGGGCCACCGCCGAGTGACGCCAAAGCCCTGGTTGACTCTGACAGCCCCGTGGGTGTGTGGGAGGCCGGGCGCTCTGGGGTCTGTCTGTCAGTGCAATCGTTTAGTGTTTTTTCAGTGGGGCGGGGCGGGAAGCGGGTGGGACCGGGCAGCCAGTTCTCAAAGGCTGTGGGGCCGACTGGAGGCCACAGCCCCTCACCCCTAGACGTTGCCAACCAGAACTGACGTGTGACCTCCTGGGTGTTGATGCCATTAAAACCAACGTTGGTGCCCGGTG