Transcript asmbl_8981

Sequence
Transcript Sequence for observation asmbl_8981 of TGE0059688:
AAATCGGCTCCTGCGCCCAAGAAGGGTTCTAAAAAGGCTGTCACCAAGGCACAGAAGAAGGACGGCAAGAAGCGCAAGCGCGGCCGCAAGGAGAGCTATTCTATCTACGTGTACAAGGTGCTGAAGCAGGTGCACCCCGACACCGGCATCTCGTCCAAGGCCATGGGCATCATGAACTCCTTCGTCAATGACATCTTCGAGCGCATCGCCAGCGAGGCCTCCCGCCTGGCACAC