Transcript asmbl_82368

Sequence
Transcript Sequence for observation asmbl_82368 of TGE0004052:
AAATTCTTGACATTACAGAACTAAACTGAAATTTATTAACATTCCACTCTTACATTTCTTATCGACAAACAGAAATAAAATTCATGAGCCAAAAAACCCAAAACAAAACTAAAAACAGGGAAAAGCTTATAAAACTAAATATGGATCCCAGCATTAACAGCTGAACAGAGAATGTGATTTTTAAATTCTTAGCGGATGATAAAGTTGTGTAGAAACTGAACACTTACAAATTATTTAAAACCTGGAATCACTGACCAGAAATTACACAGTTGGATCATGGGAGAACAGCAGAAAGGGGTTATTGAGGGAACCTACACTGTTCTAGCTGCACCCCATGCCCTTCTCAGAGGAAAGCCTGGCATTGATTAGATACTGGGCCAGACTAATACTGGCAGCAGAGCCAGTGATAGTAACCTGCCTACCAGAGGAGCCTTCCACTGGGTTGGCAATTTTGATCTGGGCCCCGGACATCTGGCGGATCTCATTAATGTTGGCGCCTTGGCGCCCGATTATGCAGCCAATTAAGTTATTTGGAATGGTGAGTTCATGGGTGGTTTGAGTAGATGCATCCAAACTTGCCCAATAGCCTTTCACCTCTGGAGAGCTGGAGTCAATTCCGGCGAATCCGGTCCCGCCGTGCATCATGGCAAAGTGAGACTGTTGTCTTGCCACCTGGTTCAGCTTGGCCAGATCGAGCGGAGAAATGGTGTGTTGTCCTTGAATCGAGTAGGCATCTAGAGGTGGTCCCTCCAGGTCATGGGTGGCATGGGGGTAGCCCGCAGCGTCGCTGCACCGATCTTGGCCGCCCGCGCAGATGACTGGGGAGCTGGCCGGCATGGGCTGGTACGGAATGGTCATGACTCTCCCTTGCGGAGACTGGGAGAGCGTCTCCAGCATGACCAGGCAAATCTGCTTGACACACTCGGTGACAGACTGCGGCACGCCAGCGATGGTGATGGCCCGCTCGGTGGAGTTGGGCAGCATATCCCCCGCCACCTGGACCTGCGCCCCCGTACTCTCGCGGATCTCTTTGATCTTACACCCGCCTTTCCCAATCAGGGAGCCGCACTGGGTGGCCGGCACCACCAGCCTCAGGGTGACCGGGGGCCTGCTGGCCGCGGTACTGTTGGTCATGGAGCTGTTGATATCTTCCTCCAGCTTGTCGATGATCATAGCGAAAGCCTTAAAGATGGCATTGGTGGGGCCGGTCAGAGTGATGATTCTCTCCGGACAATTCCCCTCCGAGATGTTGATCCGCGCGCCACTCTCCTCGCGGATCCTCTTAACCGACTCCCCTTTCTTCCCAATGATGCTTCCTACTTCCTTTCCGTGCATAAGAAGCCGAATGGTGAGAGTCACATTTAGTCCACTTTCAGTCACACCGGCATCCATGGCGAGCGGCGGGCGGCGTTCGGGGGAGTTGGGCTCGTTACGTGGTCAAGTCTTTGGCGGCTGGCGGGGGGAGGGGAGGTGTAGGCCCAAAACTGCCGGCGCGAGGCGAGCGAGGGCCGCGGGAGCGAGCGGGAGCGGGCGGGAGGCCGCAGCGTAGTCGCAGGGGCGGGCGGCGGCGGCGGAGGGGGCGAGCGGGGCCGGGAGCGGCGGGCGGGCGGG