Transcript asmbl_80127

Sequence
Transcript Sequence for observation asmbl_80127 of TGE0059686:
TTGGAAAACATTGCAGGAAAACCATGGATACCCACGAAGAAATTCCAAAATTTATTCTTTTTGACGCCAAGGGCCCAGCCCAAAAGGTTCATATTTGGTGCTTAGACAAATTCAAAATGAGGAAACATCGGCACTTGCCCTTAGTGGCCGTCTTTTGCCTCTTTCTCTCAGGCTTTCCTACAACTCATGCCCAGCAGCAGCAAGCAGTCATTGAAGTCAACAAGAGAGACATAGTCTTCCTGGTGGATGGCTCATCTGCACTGGGACTGGCCAACTTCAATGCCATCCGAGACTTCATTGCTAAAGTCATCCAGAGGCTGGAAATCGGACAGGATCTTATCCAGGTGGCAGTGGCCCAGTATGCAGACACTGTGAGGCCTGAATTTTATTTCAATACCCATCCAACAAAAAGGGAAGTCATAACCGCTGTGCGGAAAATGAAGCCCCTGGACGGCTCGGCCCTGTACACGGGCTCTGCTCTAGACTTTGTTCGTAACAACCTATTCACGAGTTCAGCCGGCTACCGGGCTGCCGAGGGGATTCCTAAGCTTTTGGTGCTGATCACAGGTGGTAAGTCCCTAGATGAAATCAGCCAGCCTGCCCAGGAGCTGAAGAGAAGCAGCATAATGGCCTTTGCCATTGGGAACAAGGGTGCCGATCAGGCTGAGCTGGAAGAGATCGCTTTCGACTCCTCCCTGGTGTTCATCCCAGCTGAGTTCCGAGCCGCCCCATTGCAAGGCATGCTGCCTGGCTTGCTGGCACCTCTCAGGACCCTCTCTGGAACCCCTGAAGTTCACTCAAACAAAAGGGATATCATCTTTCTTTTGGATGGATCAGCCAACGTTGGAAAAACCAATTTCCCTTATGTGCGCGACTTTGTAATGAACCTAGTTAACAGCCTTGATATTGGAAATGACAATATTCGTGTTGGTTTAGTGCAATTTAGTGACACTCCTGTAACGGAGTTCTCTTTAAACACATACCAGACCAAGTCAGATATCCTTGGTCATCTGAGGCAGCTGCAGCTCCAGGGAGGTTCGGGCCTGAACACAGGCTCAGCCCTAAGCTATGTCTATGCCAACCACTTCACGGAAGCTGGCGGCAGCAGGATCCGTGAACACGTGCCGCAGCTCCTGCTTCTGCTCACAGCTGGGCAGTCTGAGGACTCCTATTTGCAAGCTGCCAACGCCTTGACACGCGCGGGCATCCTGACTTTTTGTGTGGGAGCTAGCCAGGCGAATAAGGCAGAGCTTGAGCAGATTGCTTTTAACCCAAGCCTGGTGTATCTCATGGATGATTTCAGCTCCCTGCCAGCTTTGCCTCAGCAGCTGATTCAGCCCCTAACCACATATGTTAGTGGAGGTGTGGAGGAAGTACCACTCGCTCAGCCAGAGAGCAAGCGAGACATTCTGTTCCTCTTTGACGGCTCAGCCAATCTTGTGGGCCAGTTCCCTGTTGTCCGTGACTTTCTCTACAAGATTATCGATGAGCTCAATGTGAAGCCAGAGGGGACCCGAATTGCGGTGGCTCAGTACAGCGATGATGTCAAGGTGGAGTCCCGTTTTGATGAGCACCAGAGTAAGCCTGAGATCCTGAATCTTGTGAAGAGAATGAAGATCAAGACGGGCAAAGCCCTCAACCTGGGCTACGCGCTGGACTATGCACAGAGGTACATTTTTGTGAAGTCTGCTGGCAGCCGGATCGAGGATGGAGTGCTTCAGTTCCTGGTGCTGCTGGTCGCAGGAAGGTCATCTGACCGTGTGGATGGGCCAGCAAGTAACCTGAAGCAGAGTGGGGTTGTGCCTTTCATCTTCCAAGCCAAGAACGCAGACCCTGCTGAGTTAGAGCAGATCGTGCTGTCTCCAGCGTTTATCCTGGCTGCAGAGTCGCTTCCCAAGATTGGAGATCTTCATCCACAGATAGTGAATCTCTTAAAATCAGTGCACAACGGAGCACCAGCACCAGTTTCAGGTGAAAAGGACGTGGTGTTTCTGCTTGATGGCTCTGAGGGCGTCAGGAGCGGCTTCCCTCTGTTGAAAGAGTTTGTCCAGAGAGTGGTGGAAAGCCTGGATGTGGGCCAGGACCGGGTCCGCGTGGCCGTGGTGCAGTACAGCGACCGGACCAGGCCCGAGTTCTACCTGAATTCATACATGAACAAGCAGGACGTCGTCAACGCTGTCCGCCAGCTGACCCTGCTGGGAGGGCCGACCCCCAACACCGGGGCCGCCCTGGAGTTTGTCCTGAGGAACATCCTGGTCAGCTCTGCGGGAAGCAGGATAACAGAAGGTGTGCCCCAGCTGCTGATCGTCCTCACGGCCGACAGGTCTGGGGATGATGTGCGGAACCCCTCCGTGGTCGTGAAGAGGGGTGGGGCTGTGCCCATTGGCATTGGCATCGGGAACGCTGACATCACAGAGATGCAGACCATCTCCTTCATCCCGGACTTTGCCGTGGCCATTCCCACCTTTCGCCAGCTGGGGACCGTCCAACAGGTCATCTCTGAGAGGGTGACCCAGCTCACCCGCGAGGAGCTGAGCAGGCTGCAGCCGGTGTTGCAGCCTCTACCGAGCCCAGGTGTTGGTGGCAAGAGGGACGTGGTCTTTCTCATCGATGGGTCCCAAAGTGCCGGGCCTGAGTTCCAGTACGTTCGCACCCTCATAGAGAGGCTGGTTGACTACCTGGACGTGGGCTTTGACACCACCCGGGTGGCTGTCATCCAGTTCAGCGATGACCCCAAGGTGGAGTTCCTGCTGAACGCCCATTCCAGCAAGGATGAAGTGCAGAACGCGGTGCAGCGGCTGAGGCCCAAGGGAGGGCGGCAGATCAACGTGGGCAATGCCCTGGAGTACGTGTCCAGGAACATCTTCAAGAGGCCCCTGGGGAGCCGCATTGAAGAGGGCGTCCCGCAGTTCCTGGTCCTCATCTCGTCTGGAAAGTCTGACGATGAGGTGGACGACCCGGCGGTGGAGCTCAAGCAGTTTGGCGTGGCCCCTTTCACGATCGCCAGGAACGCAGACCAGGAGGAGCTGGTGAAGATCTCGCTGAGCCCCGAATATGTGTTCTCGGTGAGCACCTTCCGGGAGCTGCCCAGCCTGGAGCAGAAACTGCTGACGCCCATCACGACCCTGACCTCAGAGCAGATCCAGAAGCTCTTAGCCAGCACTCGCTATCCACCTCCAGCAGTTGAGAGTGATGCTGCAGACATTGTCTTTCTGATCGACAGCTCTGAGGGAGTTAGGCCAGATGGCTTTGCACATATTCGAGATTTTGTTAGCAGGATTGTTCGAAGACTCAACATCGGCCCCAGTAAAGTGAGAGTTGGGGTCGTGCAGTTCAGCAATGATGTCTTCCCAGAATTCTATCTGAAAACCTACAGATCCCAGGCCCCGGTGCTGGACGCCATACGGCGCCTGAGGCTCAGAGGGGGGTCCCCACTGAACACTGGCAAGGCTCTCGAATTTGTGGCAAGAAACCTCTTTGTTAAGTCTGCGGGGAGTCGCATAGAAGACGGGGTGCCCCAACACCTGGTCCTGGTCCTGGGTGGAAAATCCCAGGACGATGTGTCCAGGTTCGCCCAGGTGATCCGTTCCTCGGGCATTGTGAGTTTAGGGGTAGGAGACCGGAACATCGACAGAACAGAGCTGCAGACCATCACCAATGACCCCAGACTGGTCTTCACAGTGCGAGAGTTCAGAGAGCTTCCCAACATAGAAGAAAGAATCATGAACTCGTTTGGACCCTCCGCAGCCACTCCTGCACCTCCAGGGGTGGACACCCCTCCTCCTTCACGGCCAGAGAAGAAGAAAGCAGACATTGTGTTCCTGTTGGATGGTTCCATCAACTTCAGGAGGGACAGTTTCCAGGAAGTGCTTCGTTTTGTGTCTGAAATAGTGGACACAGTTTATGAAGATGGCGACTCCATCCAAGTGGGGCTTGTCCAGTACAACTCTGACCCCACTGACGAATTCTTCCTGAAGGACTTCTCTACCAAGAGGCAGATTATTGACGCCATCAACAAAGTGGTCTACAAAGGGGGAAGACACGCCAACACTAAGGTGGGCCTTGAGCACCTGCGGGTAAACCACTTTGTGCCTGAGGCAGGCAGCCGCCTGGACCAGCGGGTCCCTCAGATTGCCTTTGTGATCACGGGAGGAAAGTCGGTGGAAGATGCACAGGATGTGAGCCTGGCCCTCACCCAGAGGGGGGTCAAAGTGTTTGCTGTTGGAGTGAGGAATATCGACTCGGAGGAGGTTGGAAAGATAGCGTCCAACAGCGCCACAGCGTTCCGCGTGGGCAACGTCCAGGAGCTGTCCGAACTGAGCGAGCAAGTTTTGGAAACTTTGCATGATGCGATGCATGAAACCCTTTGCCCTGGTGTAACTGATGCTGCCAAAGCTTGTAATCTGGATGTGATTCTGGGGTTTGATGGTTCTAGAGACCAGAATGTTTTTGTGGCCCAGAAGGGCTTCGAGTCCAAGGTGGACGCCATCTTGAACAGAATCAGCCAGATGCACAGGGTCAGCTGCAGCGGTGGCCGCTCGCCCACCGTGCGTGTGTCAGTGGTGGCCAACACGCCCTCGGGCCCGGTGGAGGCCTTTGACTTTGACGAGTACCAGCCAGAGATGCTCGAGAAGTTCCGGAACATGCGCAGCCAGCACCCCTACGTCCTCACGGAGGACACCCTGAAGGTCTACCTGAACAAGTTCAGACAGTCCTCGCCGGACAGCGTGAAGGTGGTCATTCATTTTACTGATGGAGCAGACGGAGATCTGGCTGATTTACACAGAGCATCTGAGAACCTCCGCCAAGAAGGAGTCCGTGCCTTGATCCTGGTGGGCCTTGAACGAGTGGTCAACTTGGAGCGGCTAATGCATCTGGAGTTTGGGCGAGGGTTTATGTATGACAGGCCCCTGAGGCTTAACTTGCTGGACTTGGATTATGAACTAGCGGAGCAGCTTGACAACATTGCCGAGAAAGCTTGCTGTGGGGTTCCCTGCAAGTGCTCTGGGCAGAGGGGAGACCGCGGGCCCATCGGCAGCATCGGGCCAAAGGGTATTCCTGGAGAAGACGGCTACCGAGGCTATCCTGGTGATGAGGGTGGACCCGGTGAGCGTGGTCCGCCTGGTGTGAACGGCACTCAAGGTTTCCAGGGCTGCCCGGGCCAGAGAGGAGTAAAGGGCTCTCGGGGATTCCCAGGAGAGAAGGGCGAAGTAGGAGAAATTGGACTGGATGGTCTGGATGGTGAAGATGGAGACAAAGGATTGCCTGGTTCTTCTGGAGAGAAAGGGAATCCTGGAAGAAGGGGTGATAAAGGACCTCGAGGAGAGAAAGGAGAAAGAGGAGATGTTGGGATTCGAGGGGACCCGGGTAACCCAGGACAAGACAGCCAGGAGAGAGGACCCAAAGGAGAAACCGGTGACCTCGGCCCCATGGGTGTCCCAGGGAGAGATGGAGTACCTGGAGGACCTGGAGAAACTGGGAAGAATGGTGGCTTTGGCCGAAGGGGACCCCCCGGAGCTAAGGGCAACAAGGGCGGTCCTGGCCAGCCGGGCTTTGAGGGAGAGCAGGGGACCAGAGGTGCACAGGGCCCAGCTGGTCCTGCTGGTCCTCCAGGGCTGATAGGAGAACAAGGCATTTCTGGACCTCGGGGAAGCGGAGGTGCCGCTGGTGCTCCTGGAGAACGAGGCAGAACCGGTCCACTGGGAAGAAAGGGTGAGCCCGGAGAGCCAGGACCAAAAGGAGGAATCGGGAACCGGGGCCCTCGTGGGGAGACGGGAGATGACGGGAGAGACGGAGTTGGCAGTGAAGGACGCAGAGGCAAAAAAGGAGAAAGAGGATTCCCTGGATACCCAGGACCAAAGGGTAACCCAGGTGAACCTGGGCTAAATGGAACAACAGGACCCAAAGGCATCAGAGGCCGAAGGGGAAATTCGGGACCTCCAGGGATAGTTGGACAGAAGGGAGACCCTGGCTACCCAGGACCAGCTGGTCCCAAGGGCAACAGGGGCGACTCCATCGATCAATGTGCCCTCATCCAAAGCATCAAAGATAAATGCCCTTGCTGTTACGGGCCCCTGGAGTGCCCCGTCTTCCCAACAGAACTAGCCTTTGCTTTAGACACCTCTGAGGGAGTCAACCAAGACACTTTCGGCCGGATGCGAGATGTGGTCTTGAGTATTGTGAATGACCTGACCATTGCTGAGAGCAACTGCCCACGGGGGGCCCGGGTGGCTGTGGTCACCTACAACAACGAGGTGACCACGGAGATCCGGTTTGCTGACTCCAAGAGGAAGTCGGTCCTCCTGGACAAGATTAAGAACCTTCAGGTGGCTCTGACATCCAAACAGCAGAGTCTGGAGACTGCCATGTCGTTTGTGGCCAGGAACACATTTAAGCGTGTGAGGAACGGATTCCTAATGAGGAAAGTGGCTGTTTTCTTCAGCAACACACCCACAAGAGCATCCCCACAGCTCAGAGAGGCTGTGCTCAAGCTCTCAGATGCGGGGATCACCCCCTTGTTCCTTACAAGGCAGGAAGACCGGCAGCTCATCAACGCTTTGCAGATCAATAACACAGCAGTGGGGCATGCGCTTGTCCTGCCTGCAGGGAGAGACCTCACAGACTTCCTGGAGAATGTCCTCACGTGTCATGTTTGCTTGGACATCTGCAACATCGACCCATCCTGTGGATTTGGCAGTTGGAGGCCTTCCTTCAGGGACAGGAGAGCGGCAGGGAGCGATGTGGACATCGACATGGCTTTCATCTTAGACAGCGCTGAGACCACCACCCTGTTCCAGTTCAATGAGATGAAGAAGTACATAGCGTACCTGGTCAGACAACTGGACATGAGCCCAGATCCCAAGGCCTCCCAGCACTTCGCCAGAGTGGCAGTTGTGCAGCACGCGCCCTCTGAGTCCGTGGACAATGCCAGCATGCCACCTGTGAAGGTGGAATTCTCCCTGACTGACTATGGCTCCAAGGAGAAGCTGGTGGACTTCCTCAGCAGGGGAATGACACAGTTGCAGGGAACCAGGGCCTTAGGCAGTGCCATTGAATACACCATAGAGAATGTCTTTGAAAGTGCCCCAAACCCACGGGACCTGAAAATTGTGGTCCTGATGCTGACGGGCGAGGTGCCGGAGCAGCAGCTGGAGGAGGCCCAGAGAGTCATCCTGCAGGCCAAATGCAAGGGCTACTTCTTCGTGGTCCTGGGCATTGGCAGGAAGGTGAACATCAAGGAGGTATACACCTTCGCCAGTGAGCCAAACGACGTCTTCTTCAAATTAGTGGACAAGTCCACCGAGCTCAACGAGGAGCCTTTGATGCGCTTCGGGAGGCTGTTGCCATCCTTCGTCAGCAGTGAAAATGCTTTTTACTTGTCCCCAGATATCAGGAAACAGTGTGATTGGTTCCAAGGGGACCAACCCACAAAGAACCTTGTGAAGTTTGGTCACAAACAAGTAAATGTTCCGAATAACGTTACTTCAAGTCCTACATCCAACCCAGTGACGACAACGAAGCCGGTGACTACGACGAAGCCGGTGACCACCACAACAAAGCCTGTAACCACCACAACAAAGCCTGTGACTATTATAAATCAGCCATCTGTGAAGCCAGCCGCTGCAAAGCCGGCCCCTGCGAAACCTGTGGCTGCCAAGCCTGTGGCCACAAAGATGGCCACTGTTAGACCCCCAGTGGCGGTGAAGCCAGCAACGGCAGCGAAGCCTGTAGCAGCAAAGCCAGCAGCTGTAAGACCCCCCGCTGCTGCTGCTGCAAAACCAGTGGCGACCAAGCCTGAGGTCCCTAGGCCACAGGCAGCCAAACCAGCTGCCACCAAGCCAGCCACCACTAAGCCCATGGTTAAGATGTCCCGTGAAGTCCAGGTGTTTGAGATAACAGAGAACAGCGCCAAACTCCACTGGGAGAGGGCTGAGCCCCCCGGTCCTTATTTTTATGACCTCACCGTCACCTCAGCCCATGATCAGTCCCTGGTTCTGAAGCAGAACCTCACGGTCACGGACCGCGTCATTGGAGGCCTGCTCGCTGGGCAGACATACCATGTGGCTGTGGTCTGCTACCTGAGGTCTCAGGTCAGAGCCACCTACCACGGAAGTTTCAGTACAAAGAAATCTCAGCCCCCACCTCCACAGCCAGCAAGGTCAGCTTCTAGTTCAACCATCAATCTAATGGTGAGCACAGAACCATTGGCTCTCACTGAAACAGATATATGCAAGTTGCCGAAAGACGAAGGAACTTGCAGGGATTTCATATTAAAATGGTACTATGATCCAAACACCAAAAGCTGTGCAAGATTCTGGTATGGAGGTTGTGGTGGAAACGAAAACAAATTTGGATCACAGAAAGAATGTGAAAAGGTTTGCGCTCCTGTGCTCGCCAAACCCGGAGTCATCAGTGTGATGGGAACCTAAGCGTGGGTGGCCAACATCATATACCTCTTGAAGAAGAAGGAGTCAGCCATCGCCAACTTGTCTCTGTAGAAGCTCCGGGTGTAGATTCCCTTGCACTGTATCATTTCATGCTTTGATTTACACTCGAACTCGGGAGGGAACATCCTGCTGCATGACCTATCAGTATGGTGCTAATGTGTCTGTGGACCCTCGCTCTCTGTCTCCAGGCAGTTCTCTCGAATACTTTGAATGTTGTGTAACAGTTAGCCACTGCTGGTGTTTATGTGAACATTCCTATCAATCCAAATTCCCTCTGGAGTTTCATGTTATGCCTGTTGCAGGCAAATGTAAAGTCTAGAAAATAATGCAAATGTCACGGCTACTCTATATACTTTTGCTTGGTTCATTTTTTTTCCCTTTTAGTTAAGCATGACTTTAGATGGGAAGCCTGTGTATCGTGGAGAAACAAGAGACCAACTTTTTCATTCCCTGCCCCCAATTTCCCAGACTAGATTTCAAGCTAATTTTCTTTTTCTGAAGCCTCTAACAAATGATCTAGTTCAGAAGGAAGCAAAATCCCTTAATCTATGTGCACCGTTGGGACCAATGCCTTAATTAAAGAATTTAAAAAAGTTGTAATAGAGAATATTTTTGGCATTCCTCTAATGTTGTGTGTTTTTTTTTTGTGTGTGCTGGAGGGAGGGGATTTAATTTTAATTTTAAAATGTTTAGGAAATTTATACAAAGAAACTTTTTAATAAAGTATATTGAAAGTTT