Transcript asmbl_80123

Sequence
Transcript Sequence for observation asmbl_80123 of TGE0057077:
CCATGATTTCTAAGAGGTTGCCTCTTATCCATTCAGAATGCAGAACTGAAAGAGAATTTCACATTCCTTCATCAACATGTGTTTTGTTTGCCCATATTTCGTGTTTCTTATTGGTTTCCAAAGAAACATGTCAGAACACTGAATAATGCATGTGGTCACTTGTTCTAATGCTTTCACATTTTTTGCATTTCTTTCTTTTAAAGCACAAGACTCTGCTGACATTATTTTCCTTATTGATGGATCAAACAACACCGGAAGTGTCAATTTCGCAGTCATTCTCGACTTCCTTGTAAATCTCCTTGAGAAACTCCCAATTGGAACTCAGCAGATCCGAGTGGGGGTGGTCCAGTTTAGCGATGAGCCCAGAACCATGTTCTCCTTGGACACCTACTCCACCAAGGCCCAGGTTCTGGGTGCAGTGAAAGCCCTCGGGTTTGCTGGTGGGGAGTTGGCCAATATCGGCCTCGCCCTTGATTTCGTGGTGGAGAACCACTTCACCCGGGCAGGGGGCAGCCGCGTGGAGGAAGGGGTTCCCCAGGTGCTGGTCCTCATAAGTGCCGGGCCTTCTAGTGACGAGATTCGCTACGGGGTGGTAGCACTGAAGCAGGCTAGCGTGTTCTCATTCGGCCTTGGAGCCCAGGCCGCCTCCAGGGCAGAGCTTCAGCACATAGCTACCGATGACAACTTGGTGTTTACTGTCCCGGAATTCCGTAGCTTTGGGGACCTCCAGGAGAAATTACTGCCGTACATTGTTGGCGTGGCCCAAAGGCACATTGTCTTGAAACCGCCAACCATTGTCACACAAGTCATTGAAGTCAACAAGAGAGACATAGTCTTCCTGGTGGATGGCTCATCTGCACTGGGACTGGCCAACTTCAATGCCATCCGAGACTTCATTGCTAAAGTCATCCAGAGGCTGGAAATCGGACAGGATCTTATCCAGGTGGCAGTGGCCCAGTATGCAGACACTGTGAGGCCTGAATTTTATTTCAATACCCATCCAACAAAAAGGGAAGTCATAACCGCTGTGCGGAAAATGAAGCCCCTGGACGGCTCGGCCCTGTACACGGGCTCTGCTCTAGACTTTGTTCGTAACAACCTATTCACGAGTTCAGCCGGCTACCGGGCTGCCGAGGGGATTCCTAAGCTTTTGGTGCTGATCACAGGTGGTAAGTCCCTAGATGAAATCAGCCAGCCTGCCCAGGAGCTGAAGAGAAGCAGCATAATGGCCTTTGCCATTGGGAACAAGGGTGCCGATCAGGCTGAGCTGGAAGAGATCGCTTTCGACTCCTCCCTGGTGTTCATCCCAGCTGAGTTCCGAGCCGCCCCATTGCAAGGCATGCTGCCTGGCTTGCTGGCACCTCTCAGGACCCTCTCTGGAACCCCTGAAGTTCACTCAAACAAAAGGGATATCATCTTTCTTTTGGATGGATCAGCCAACGTTGGAAAAACCAATTTCCCTTATGTGCGCGACTTTGTAATGAACCTAGTTAACAGCCTTGATATTGGAAATGACAATATTCGTGTTGGTTTAGTGCAATTTAGTGACACTCCTGTAACGGAGTTCTCTTTAAACACATACCAGACCAAGTCAGATATCCTTGGTCATCTGAGGCAGCTGCAGCTCCAGGGAGGTTCGGGCCTGAACACAGGCTCAGCCCTAAGCTATGTCTATGCCAACCACTTCACGGAAGCTGGCGGCAGCAGGATCCGTGAACACGTGCCGCAGCTCCTGCTTCTGCTCACAGCTGGGCAGTCTGAGGACTCCTATTTGCAAGCTGCCAACGCCTTGACACGCGCGGGCATCCTGACTTTTTGTGTGGGAGCTAGCCAGGCGAATAAGGCAGAGCTTGAGCAGATTGCTTTTAACCCAAGCCTGGTGTATCTCATGGATGATTTCAGCTCCCTGCCAGCTTTGCCTCAGCAGCTGATTCAGCCCCTAACCACATATGTTAGTGGAGGTGTGGAGGAAGTACCACTCGCTCAGCCAGAGAGCAAGCGAGACATTCTGTTCCTCTTTGACGGCTCAGCCAATCTTGTGGGCCAGTTCCCTGTTGTCCGTGACTTTCTCTACAAGATTATCGATGAGCTCAATGTGAAGCCAGAGGGGACCCGAATTGCGGTGGCTCAGTACAGCGATGATGTCAAGGTGGAGTCCCGTTTTGATGAGCACCAGAGTAAGCCTGAGATCCTGAATCTTGTGAAGAGAATGAAGATCAAGACGGGCAAAGCCCTCAACCTGGGCTACGCGCTGGACTATGCACAGAGGTACATTTTTGTGAAGTCTGCTGGCAGCCGGATCGAGGATGGAGTGCTTCAGTTCCTGGTGCTGCTGGTCGCAGGAAGGTCATCTGACCGTGTGGATGGGCCAGCAAGTAACCTGAAGCAGAGTGGGGTTGTGCCTTTCATCTTCCAAGCCAAGAACGCAGACCCTGCTGAGTTAGAGCAGATCGTGCTGTCTCCAGCGTTTATCCTGGCTGCAGAGTCGCTTCCCAAGATTGGAGATCTTCATCCACAGATAGTGAATCTCTTAAAATCAGTGCACAACGGAGCACCAGCACCAGTTTCAGGTGAAAAGGACGTGGTGTTTCTGCTTGATGGCTCTGAGGGCGTCAGGAGCGGCTTCCCTCTGTTGAAAGAGTTTGTCCAGAGAGTGGTGGAAAGCCTGGATGTGGGCCAGGACCGGGTCCGCGTGGCCGTGGTGCAGTACAGCGACCGGACCAGGCCCGAGTTCTACCTGAATTCATACATGAACAAGCAGGACGTCGTCAACGCTGTCCGCCAGCTGACCCTGCTGGGAGGGCCGACCCCCAACACCGGGGCCGCCCTGGAGTTTGTCCTGAGGAACATCCTGGTCAGCTCTGCGGGAAGCAGGATAACAGAAGGTGTGCCCCAGCTGCTGATCGTCCTCACGGCCGACAGGTCTGGGGATGATGTGCGGAACCCCTCCGTGGTCGTGAAGAGGGGTGGGGCTGTGCCCATTGGCATTGGCATCGGGAACGCTGACATCACAGAGATGCAGACCATCTCCTTCATCCCGGACTTTGCCGTGGCCATTCCCACCTTTCGCCAGCTGGGGACCGTCCAACAGGTCATCTCTGAGAGGGTGACCCAGCTCACCCGCGAGGAGCTGAGCAGGCTGCAGCCGGTGTTGCAGCCTCTACCGAGCCCAGGTGTTGGTGGCAAGAGGGACGTGGTCTTTCTCATCGATGGGTCCCAAAGTGCCGGGCCTGAGTTCCAGTACGTTCGCACCCTCATAGAGAGGCTGGTTGACTACCTGGACGTGGGCTTTGACACCACCCGGGTGGCTGTCATCCAGTTCAGCGATGACCCCAAGGTGGAGTTCCTGCTGAACGCCCATTCCAGCAAGGATGAAGTGCAGAACGCGGTGCAGCGGCTGAGGCCCAAGGGAGGGCGGCAGATCAACGTGGGCAATGCCCTGGAGTACGTGTCCAGGAACATCTTCAAGAGGCCCCTGGGGAGCCGCATTGAAGAGGGCGTCCCGCAGTTCCTGGTCCTCATCTCGTCTGGAAAGTCTGACGATGAGGTGGACGACCCGGCGGTGGAGCTCAAGCAGTTTGGCGTGGCCCCTTTCACGATCGCCAGGAACGCAGACCAGGAGGAGCTGGTGAAGATCTCGCTGAGCCCCGAATATGTGTTCTCGGTGAGCACCTTCCGGGAGCTGCCCAGCCTGGAGCAGAAACTGCTGACGCCCATCACGACCCTGACCTCAGAGCAGATCCAGAAGCTCTTAGCCAGCACTCGCTATCCACCTCCAGCAGTTGAGAGTGATGCTGCAGACATTGTCTTTCTGATCGACAGCTCTGAGGGAGTTAGGCCAGATGGCTTTGCACATATTCGAGATTTTGTTAGCAGGATTGTTCGAAGACTCAACATCGGCCCCAGTAAAGTGAGAGTTGGGGTCGTGCAGTTCAGCAATGATGTCTTCCCAGAATTCTATCTGAAAACCTACAGATCCCAGGCCCCGGTGCTGGACGCCATACGGCGCCTGAGGCTCAGAGGGGGGTCCCCACTGAACACTGGCAAGGCTCTCGAATTTGTGGCAAGAAACCTCTTTGTTAAGTCTGCGGGGAGTCGCATAGAAGACGGGGTGCCCCAACACCTGGTCCTGGTCCTGGGTGGAAAATCCCAGGACGATGTGTCCAGGTTCGCCCAGGTGATCCGTTCCTCGGGCATTGTGAGTTTAGGGGTAGGAGACCGGAACATCGACAGAACAGAGCTGCAGACCATCACCAATGACCCCAGACTGGTCTTCACAGTGCGAGAGTTCAGAGAGCTTCCCAACATAGAAGAAAGAATCATGAACTCGTTTGGACCCTCCGCAGCCACTCCTGCACCTCCAGGGGTGGACACCCCTCCTCCTTCACGGCCAGAGAAGAAGAAAGCAGACATTGTGTTCCTGTTGGATGGTTCCATCAACTTCAGGAGGGACAGTTTCCAGGAAGTGCTTCGTTTTGTGTCTGAAATAGTGGACACAGTTTATGAAGATGGCGACTCCATCCAAGTGGGGCTTGTCCAGTACAACTCTGACCCCACTGACGAATTCTTCCTGAAGGACTTCTCTACCAAGAGGCAGATTATTGACGCCATCAACAAAGTGGTCTACAAAGGGGGAAGACACGCCAACACTAAGGTGGGCCTTGAGCACCTGCGGGTAAACCACTTTGTGCCTGAGGCAGGCAGCCGCCTGGACCAGCGGGTCCCTCAGATTGCCTTTGTGATCACGGGAGGAAAGTCGGTGGAAGATGCACAGGATGTGAGCCTGGCCCTCACCCAGAGGGGGGTCAAAGTGTTTGCTGTTGGAGTGAGGAATATCGACTCGGAGGAGGTTGGAAAGATAGCGTCCAACAGCGCCACAGCGTTCCGCGTGGGCAACGTCCAGGAGCTGTCCGAACTGAGCGAGCAAGTTTTGGAAACTTTGCATGATGCGATGCATGAAACCCTTTGCCCTGGTGTAACTGATGCTGCCAAAGCTTGTAATCTGGATGTGATTCTGGGGTTTGATGGTTCTAGAGACCAGAATGTTTTTGTGGCCCAGAAGGGCTTCGAGTCCAAGGTGGACGCCATCTTGAACAGAATCAGCCAGATGCACAGGGTCAGCTGCAGCGGTGGCCGCTCGCCCACCGTGCGTGTGTCAGTGGTGGCCAACACGCCCTCGGGCCCGGTGGAGGCCTTTGACTTTGACGAGTACCAGCCAGAGATGCTCGAGAAGTTCCGGAACATGCGCAGCCAGCACCCCTACGTCCTCACGGAGGACACCCTGAAGGTCTACCTGAACAAGTTCAGACAGTCCTCGCCGGACAGCGTGAAGGTGGTCATTCATTTTACTGATGGAGCAGACGGAGATCTGGCTGATTTACACAGAGCATCTGAGAACCTCCGCCAAGAAGGAGTCCGTGCCTTGATCCTGGTGGGCCTTGAACGAGTGGTCAACTTGGAGCGGCTAATGCATCTGGAGTTTGGGCGAGGGTTTATGTATGACAGGCCCCTGAGGCTTAACTTGCTGGACTTGGATTATGAACTAGCGGAGCAGCTTGACAACATTGCCGAGAAAGCTTGCTGTGGGGTTCCCTGCAAGTGCTCTGGGCAGAGGGGAGACCGCGGGCCCATCGGCAGCATCGGGCCAAAGGGTATTCCTGGAGAAGACGGCTACCGAGGCTATCCTGGTGATGAGGGTGGACCCGGTGAGCGTGGTCCGCCTGGTGTGAACGGCACTCAAGGTTTCCAGGGCTGCCCGGGCCAGAGAGGAGTAAAGGGCTCTCGGGGATTCCCAGGAGAGAAGGGCGAAGTAGGAGAAATTGGACTGGATGGTCTGGATGGTGAAGATGGAGACAAAGGATTGCCTGGTTCTTCTGGAGAGAAAGGGAATCCTGGAAGAAGGGGTGATAAAGGACCTCGAGGAGAGAAAGGAGAAAGAGGAGATGTTGGGATTCGAGGGGACCCGGGTAACCCAGGACAAGACAGCCAGGAGAGAGGACCCAAAGGAGAAACCGGTGACCTCGGCCCCATGGGTGTCCCAGGGAGAGATGGAGTACCTGGAGGACCTGGAGAAACTGGGAAGAATGGTGGCTTTGGCCGAAGGGGACCCCCCGGAGCTAAGGGCAACAAGGGCGGTCCTGGCCAGCCGGGCTTTGAGGGAGAGCAGGGGACCAGAGGTGCACAGGGCCCAGCTGGTCCTGCTGGTCCTCCAGGGCTGATAGGAGAACAAGGCATTTCTGGACCTCGGGGAAGCGGAGGTGCCGCTGGTGCTCCTGGAGAACGAGGCAGAACCGGTCCACTGGGAAGAAAGGGTGAGCCCGGAGAGCCAGGACCAAAAGGAGGAATCGGGAACCGGGGCCCTCGTGGGGAGACGGGAGATGACGGGAGAGACGGAGTTGGCAGTGAAGGACGCAGAGGCAAAAAAGGAGAAAGAGGATTCCCTGGATACCCAGGACCAAAGGGTAACCCAGGTGAACCTGGGCTAAATGGAACAACAGGACCCAAAGGCATCAGAGGCCGAAGGGGAAATTCGGGACCTCCAGGGATAGTTGGACAGAAGGGAGACCCTGGCTACCCAGGACCAGCTGGTCCCAAGGGCAACAGGGGCGACTCCATCGATCAATGTGCCCTCATCCAAAGCATCAAAGATAAATGCCCTTGCTGTTACGGGCCCCTGGAGTGCCCCGTCTTCCCAACAGAACTAGCCTTTGCTTTAGACACCTCTGAGGGAGTCAACCAAGACACTTTCGGCCGGATGCGAGATGTGGTCTTGAGTATTGTGAATGACCTGACCATTGCTGAGAGCAACTGCCCACGGGGGGCCCGGGTGGCTGTGGTCACCTACAACAACGAGGTGACCACGGAGATCCGGTTTGCTGACTCCAAGAGGAAGTCGGTCCTCCTGGACAAGATTAAGAACCTTCAGGTGGCTCTGACATCCAAACAGCAGAGTCTGGAGACTGCCATGTCGTTTGTGGCCAGGAACACATTTAAGCGTGTGAGGAACGGATTCCTAATGAGGAAAGTGGCTGTTTTCTTCAGCAACACACCCACAAGAGCATCCCCACAGCTCAGAGAGGCTGTGCTCAAGCTCTCAGATGCGGGGATCACCCCCTTGTTCCTTACAAGGCAGGAAGACCGGCAGCTCATCAACGCTTTGCAGATCAATAACACAGCAGTGGGGCATGCGCTTGTCCTGCCTGCAGGGAGAGACCTCACAGACTTCCTGGAGAATGTCCTCACGTGTCATGTTTGCTTGGACATCTGCAACATCGACCCATCCTGTGGATTTGGCAGTTGGAGGCCTTCCTTCAGGGACAGGAGAGCGGCAGGGAGCGATGTGGACATCGACATGGCTTTCATCTTAGACAGCGCTGAGACCACCACCCTGTTCCAGTTCAATGAGATGAAGAAGTACATAGCGTACCTGGTCAGACAACTGGACATGAGCCCAGATCCCAAGGCCTCCCAGCACTTCGCCAGAGTGGCAGTTGTGCAGCACGCGCCCTCTGAGTCCGTGGACAATGCCAGCATGCCACCTGTGAAGGTGGAATTCTCCCTGACTGACTATGGCTCCAAGGAGAAGCTGGTGGACTTCCTCAGCAGGGGAATGACACAGTTGCAGGGAACCAGGGCCTTAGGCAGTGCCATTGAATACACCATAGAGAATGTCTTTGAAAGTGCCCCAAACCCACGGGACCTGAAAATTGTGGTCCTGATGCTGACGGGCGAGGTGCCGGAGCAGCAGCTGGAGGAGGCCCAGAGAGTCATCCTGCAGGCCAAATGCAAGGGCTACTTCTTCGTGGTCCTGGGCATTGGCAGGAAGGTGAACATCAAGGAGGTATACACCTTCGCCAGTGAGCCAAACGACGTCTTCTTCAAATTAGTGGACAAGTCCACCGAGCTCAACGAGGAGCCTTTGATGCGCTTCGGGAGGCTGTTGCCATCCTTCGTCAGCAGTGAAAATGCTTTTTACTTGTCCCCAGATATCAGGAAACAGTGTGATTGGTTCCAAGGGGACCAACCCACAAAGAACCTTGTGAAGTTTGGTCACAAACAAGTAAATGTTCCGAATAACGTTACTTCAAGTCCTACATCCAACCCAGTGACGACAACGAAGCCGGTGACTACGACGAAGCCGGTGACCACCACAACAAAGCCTGTAACCACCACAACAAAGCCTGTGACTATTATAAATCAGCCATCTGTGAAGCCAGCCGCTGCAAAGCCGGCCCCTGCGAAACCTGTGGCTGCCAAGCCTGTGGCCACAAAGATGGCCACTGTTAGACCCCCAGTGGCGGTGAAGCCAGCAACGGCAGCGAAGCCTGTAGCAGCAAAGCCAGCAGCTGTAAGACCCCCCGCTGCTGCTGCTGCAAAACCAGTGGCGACCAAGCCTGAGGTCCCTAGGCCACAGGCAGCCAAACCAGCTGCCACCAAGCCAGCCACCACTAAGCCCATGGTTAAGATGTCCCGTGAAGTCCAGGTGTTTGAGATAACAGAGAACAGCGCCAAACTCCACTGGGAGAGGGCTGAGCCCCCCGGTCCTTATTTTTATGACCTCACCGTCACCTCAGCCCATGATCAGTCCCTGGTTCTGAAGCAGAACCTCACGGTCACGGACCGCGTCATTGGAGGCCTGCTCGCTGGGCAGACATACCATGTGGCTGTGGTCTGCTACCTGAGGTCTCAGGTCAGAGCCACCTACCACGGAAGTTTCAGTACAAAGAAATCTCAGCCCCCACCTCCACAGCCAGCAAGGTCAGCTTCTAGTTCAACCATCAATCTAATGGTGAGCACAGAACCATTGGCTCTCACTGAAACAGATATATGCAAGTTGCCGAAAGACGAAGGAACTTGCAGGGATTTCATATTAAAATGGTACTATGATCCAAACACCAAAAGCTGTGCAAGATTCTGGTATGGAGGTTGTGGTGGAAACGAAAACAAATTTGGATCACAGAAAGAATGTGAAAAGGTTTGCGCTCCTGTGCTCGCCAAACCCGGAGTCATCAGTGTGATGGGAACCTAAGCGTGGGTGGCCAACATCATATACCTCTTGAAGAAGAAGGAGTCAGCCATCGCCAACTTGTCTCTGTAGAAGCTCCGGGTGTAGATTCCCTTGCACTGTATCATTTCATGCTTTGATTTACACTCGAACTCGGGAGGGAACATCCTGCTGCATGACCTATCAGTATGGTGCTAATGTGTCTGTGGACCCTCGCTCTCTGTCTCCAGGCAGTTCTCTCGAATACTTTGAATGTTGTGTAACAGTTAGCCACTGCTGGTGTTTATGTGAACATTCCTATCAATCCAAATTCCCTCTGGAGTTTCATGTTATGCCTGTTGCAGGCAAATGTAAAGTCTAGAAAATAATGCAAATGTCACGGCTACTCTATATACTTTTGCTTGGTTCATTTTTTTTCCCTTTTAGTTAAGCATGACTTTAGATGGGAAGCCTGTGTATCGTGGAGAAACAAGAGACCAACTTTTTCATTCCCTGCCCCCAATTTCCCAGACTAGATTTCAAGCTAATTTTCTTTTTCTGAAGCCTCTAACAAATGATCTAGTTCAGAAGGAAGCAAAATCCCTTAATCTATGTGCACCGTTGGGACCAATGCCTTAATTAAAGAATTTAAAAAAGTTGTAATAGAGAATATTTTTGGCATTCCTCTAATGTTGTGTGTTTTTTTTTTGTGTGTGCTGGAGGGAGGGGATTTAATTTTAATTTTAAAATGTTTAGGAAATTTATACAAAGAAACTTTTTAATAAAGTATATTGAAAGTTT