Transcript asmbl_79860

Sequence
Transcript Sequence for observation asmbl_79860 of TGE0056300:
AAGGACTTAACATGTTACACGTTTTTTAAAAAAAATTTAATGGCATGTGTGATTTTTTTTTTCCCTTGATCACACCAATGTCAGAATAACAATACTACCCAATCATCAATATTAGAATCATTGTTTCTTACTGCTAAAACCTTTGAAAAGAATTATGACCATAATGGTTGTCATTTAGTTCTACATGTGGTTGTCATTTTAGTTCTACATGGCTGTAAAATGGATTCATATGATTGTGAAAATGTTCTTAGCCATTGTCAAAGGTGCATAAGTTTTGTCAGTTTGTAATGAAGTCAGCATTTTTAAACTTTTTGTTACAAGAATAGTTTTATGTATCATATTCTTCAAAACAATGTAGTCAAATAATGAATCGGAAAAGAGCAAAGAACCAGTACTTCATGAAAACTACCATAACGTAAATTCCCCTTCTCTCCCCTGGATGGAAGTATCAATTTGGAAGTTACTAGGAAAAGGTAAGGGAACTGACTGAGGACACTAGGCTTACCTTTTAATTTCGAAGAGTAACTGGATTATTTCAGGTTGCTACGATTTCTGCAAACGGAGACAAAGAAATTGGCAATATCATCTCTGATGCAATGAAAAAAGTTGGAAGAAAGGGTGTCATCACAGTAAAGGATGGAAAAACACTGAATGATGAATTAGAAATTATTGAAGGCATGAAGTTTGATCGAGGCTATATTTCTCCATACTTTATTAATACATCAAAAGGTCAGAAATGTGAATTCCAGGATGCCTATGTTCTGTTGAGTGAAAAGAAAATTTCTAGTATCCAGTCCATTGTACCTGCTCTTGAAATTGCCAATGCTCACCGTAAGCCTTTGGTCATAATCGCTGAAGATGTTGATGGAGAAGCTCTAAGTACACTCGTCTTGAATAGGCTAAAGGTTGGTCTTCAGGTTGTGGCAGTCAAGGCTCCAGGGTTTGGTGACAATAGAAAGAACCAGCTTAAAGATATGGCTATTGCTACTGGTGGTGCAGTGTTTGGAGAAGAGGGATTGACCCTGAATCTTGAAGACGTTCAGCCTCATGACTTAGGAAAAGTTGGAGAGGTCATTGTGACCAAAGACGATGCCATGCTCTTAAAAGGAAAAGGTGACAAGGCTCAAATTGAAAAACGTATTCAAGAAATCATTGAGCAGTTAGATGTCACAACTAGTGAATATGAAAAGGAAAAACTGAATGAACGGCTTGCAAAACTTTCAGATGGAGTGGCTGTGCTGAAGGTTGGTGGGACAAGTGATGTTGAAGTGAATGAAAAGAAAGACAGAGTTACAGATGCCCTTAATGCTACAAGAGCTGCTGTTGAAGAAGGCATTGTTTTGGGAGGGGGTTGTGCCCTCCTTCGATGCATTCCAGCCTTGGACTCATTGACTCCAGCTAATGAAGATCAAAAAATTGGTATAGAAATTATTAAAAGAACACTCAAAATTCCAGCAATGACCATTGCTAAGAATGCAGGTGTTGAAGGATCTTTGATAGTTGAGAAAATTATGCAAAGTTCCTCAGAAGTTGGTTATGATGCTATGGCTGGAGATTTTGTGAATATGGTGGAAAAAGGAATCATTGACCCAACAAAGGTTGTGAGAACTGCTTTATTGGATGCTGCTGGTGTGGCCTCTCTGTTAACTACAGCAGAAGTTGTAGTCACAGAAATTCCTAAAGAAGAGAAGGACCCTGGAATGGGTGCAATGGGTGGAATGGGAGGTGGTATGGGAGGTGGCATGTTCTAACTCCTAGACTAGTGCTTTACCTTTATTAATGAACTGTGACAGGAAGCCCAAGGCAGTGTTCCTCACCAATAACTTCAGAGAAGTCAGTTGGAGAAAATGAAGAAAAAGGCTGGCTGAAAATCACTATAACCATCAGTTACTGGTTTCAGTTGACAAAATATATAATGGTTTACTGCTGTCATTGTCCATGCCTACAGATAATTTATTTTGTATTTTTGAATAAAAAACATTTGTACATTCCTGATACTGGGTACAAGAGCCATGTACCAGTGTACTGCTTTCAACTTAAATCACTGAGGCATTTTTACTACTATTCTGTTAAAATCAGGATTTTAGTGCTTGCCACCACCAGATGAGAAGTTAAGCAGCCTTTCTGTGGAGAGTGAGAATAATTGTGTACAAAGTAGAGAAGTATCCAATTATGTGACAACCTTTGTGTAATAAAAATTTGTTTAAAGTTAATA