Transcript asmbl_79261

Sequence
Transcript Sequence for observation asmbl_79261 of TGE0059677:
TGCCCCATTGACTCTTTCCACACCACTGCATGCACCAGGGGATTTGCATATTGTCCCACAGGGAGGACCTTCCCTTGTGAGTCTGAGATAAAAGCTCAGCTGTAACTGTGCCTTGACTGATCAGGACTCCTCAGTTCACCTTCTCACAATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCTCTGGGTCTCTGGATCCAGTGGGGATATTGTGATGACCCAGCATCTGCTCTCCCTGCCCATCCCTCTGGGAGAGCCGGCCTCCATCTCCTGCAGGTCTAGTCAGAGCCTCCTGCATAGTGATGGAAACACCTATTTGGATTGGTACCTGCAGAAGCCAGGCCAGTCTCCACAGCTTCTTATCTACACAATTTCTAACAAATTCTATGGAGTCCCAAACAAGTTCAGTGGCAGCAGGTCAGGGACAGGTTTCACACTTAAATTCAGCAAAGTGGAGGCTGAGGATGTTGGGGTTTATTGCTGTGAACAGGGTCTGCAAGGTCCTCACACAGTGTTTTGGCCAGGGGACCAAGCTGGAGATCAAACGAACTGTGGCTGCACCATCTGTCTTCATCTTCCCGCCATCTGATGAGCAGTTGAAATCTGGAACTGCCTCTGTTGTGTGCCTGCTGAATAACTTCTATCCCAGAGAGGCCAAAGTACAGTGGAAGGTGGATAACGCCCTCCAATCGGGTAACTCCCAGGAGAGTGTCACAGAGCAGGACAGCAAGGACAGCACCTACAGCCTCAGCAGCACCCTGACGCTGAGCAAAGCAGACTACGAGAAACACAAAGTCTACGCCTGCGAAGTCACCCATCAGGGCCTGAGCTCGCCCGTCACAAAGAGCTTCAACAGGGGAGAGTGTTAGAGGGAGAAGTGCCCCCACCTGCTCCTCAGTTCCAGCCTGACCCCCTCCCATCCTTTGGCCTCTGACCCTTTTTCCACAGGGGACCTACCCCTATTGCGGTCCTCCAGCTCATCTTTCACCTCACCCCCCTCCTCCTCCTTGGCTTTAATTATGCTAATGTTGGAGGAGAATGAATAAATAAAGTGAATCTTTGCACCTGTGGTTTCTCTCTTTCCTCATTTAATAATTATTATCTGTTGTTTTACCAACTACTCAATTTCTCTTATAAGGGACTAAATATGTAGTCATCCTAAGGCGCATAACCATTTATAAAAATCATCCTTCATTCTATTTTACCCTATCATCCTCTGCAAGACAGTCCTCCCTCAAACCCACAAGCCTTCTGTCCTCACAGTCCCCTGGGCCATGGTAGGAGAGACTTGCTTCCTTGTTTTCCCCTCCTCAGCAAGCCCTCATAGTCCTTTTTAAGGGTGACAGGTCTTACAGTCATATATCCTTTGATTCAATTCCCTGAGAATCAACCAAAGCAAATTTTTCAAAAGAAGAAACCTGCTATAAAGAGAATCATTCATTGCAACATGATATAAAATAACAACAC