Transcript asmbl_79230

Sequence
Transcript Sequence for observation asmbl_79230 of TGE0001397:
GCTTCCGGTGCGCCGGGCGCGGACGCGGGCACGCACACACGCAAGCACGCCTCCACTTAACTCGCGCCGCCGCGGCAGCTCGAGTCCACCAGCAGCGCCGTCCGCTTGACCGAGATGCTGCGGGCCTGTCAGTTATCGGGTGTGACCGCCGCCGCCCAGAGTTGTCTCTGTGGGAAGTTTGTCCTCCGTCCATTGCGACCATGCCGCAGATACTCTACTTCAGGCAGCTCTGGGTTGACTACTGGCAAAATTGCTGGAGCTGGCCTTTTGTTTGTTGGTGGAGGTATTGGTGGCACTATCCTATATGCCAAATGGGATTCCCATTTCCGGGAAAGTGTAGAGAAAACCATACCTTACTCAGACAAACTCTTCGAGATGGTTCTTGGTCCTGCAGCTTATAATGTTCCATTGCCAAAGAAATCGATTCAGTCGGGTCCACTAAAAATCTCTAGTGTATCAGAAGTAATGAAAGAATCTAAACAGCCTGCCTCACAACTCCAAAAACAAAAGGGAGATACTCCAGCTTCAGCAACAGCAGGTGATACCCTGTCGGTCCCAGCCCCTGCAGTTCAGCCTGAGGAATCTTTAAAAACTGATCACCCTGAAATTGGTGAAGGAAAACCCACACCTGCACTTTCAGAAGAAGCATCCTCATCTTCTATAAGGGAGCGACCACCTGAAGAAGTTGCAGCTCGCCTTGCACAACAGGAAAAACAAGAACAAGTTAAAATTGAGTCTCTAGCCAAGAGCTTAGAAGATGCTCTGAGGCAAACTGCAAGTGTCACTCTGCAGGCTATTGCAGCTCAGAATGCTGCGGTCCAGGCTGTCAATGCACACTCCAACATATTGAAAGCCGCCATGGACAATTCTGAGATTGCAGGCGAGAAGAAATCTGCTCAGTGGCGCACAGTGGAGGGTGCATTGAAGGAACGCAGAAAGGCAGTAGATGAAGCTGCCGATGCCCTTCTCAAAGCCAAAGAAGAGTTAGAGAAGATGAAAAGTGTGATTGAAAATGCAAAGAAAAAAGAGGTTGCTGGGGCCAAGCCTCATATAACTGCTGCAGAGGGTAAACTTCACAACATGATAGTTGATCTGGATAATGTGGTCAAAAAGGTCCAAGCAGCTCAGTCTGAGGCTAAGGTTGTATCTCAGTATCATGAGCTGGTGGTCCAAGCTCGGGATGACTTTAAACGAGAGCTGGACAGTATTACTCCAGAAGTCCTTCCTGGGTGGAAAGGAATGAGTGAGTACAACTGAACTGACAAGCTCTCTACTGATGATCTGAACTCCCTCATTGCTCATGCACATCGTCGTATTGATCAGCTGAACAGAGAGCTGGCAGAACAGAAGGCCACCGAAAAGCAGCACATCACGTTAGCCTTGGAGAAACAAAAGCTGGAAGAAAAGCGGGCATTTGACTCTGCAGTAGCAAAAGCATTAGAACATCACAGAAGTGAAATACAGGCTGAACAGGACAGAAAGATAGAAGAAGTCAGAGATGCCATGGAAAATGAAATGAGAACCCAGCTTCGCCGACAGGCAGCTGCCCACACTGATCACTTGCGAGATGTCCTTAGGGTACAAGAACAGGAATTGAAGTCTGAATTTGAGCAGAACCTGTCTGAGAAACTCTCTGAACAAGAATTACAATTTCGTCGTCTCAGTCAAGAGCAAGTTGACAACTTTACTCTGGATATAAATACTGCCTATGCCAGACTCAGAGGAATCGAACAGGCTGTTCAGAGCCATGCAGTTGCTGAAGAGGAAGCCAGAAAAGCCCACCAACTCTGGCTTTCAGTGGAGGCATTAAAGTACAGCATGAAGACCTCATCTGCAGAAACACCTACTATCCCGCTGGGTAGTGCAGTTGAGGCCATCAAAGCCAACTGTTCTGATAATGAATTCACCCAAGCTTTAACCGCAGCTATCCCTCCAGAGTCCCTGACCCGTGGGGTGTACAGTGAAGAGACCCTTAGAGCCCGTTTCTATGCTGTTCAAAAACTGGCCCGAAGGGTAGCAATGATTGATGAAACCAGAAATAGCTTGTACCAGTACTTCCTCTCCTACCTACAGTCCCTGCTCCTATTCCCACCTCAGCAACTGAAGCCGCCCCCAGAGCTCTGCCCTGAGGATATAAACACATTTAAATTACTGTCATATGCTTCCTATTGCATTGAGCATGGTGATCTGGAGCTAGCAGCAAAGTTTGTCAATCAGCTGAAGGGGGAATCCAGACGAGTGGCACAGGACTGGCTGAAGGAAGCCCGAATGACCCTAGAAACGAAACAGATAGTGGAAATCCTGACAGCATATGCCAGCGCCGTAGGAATAGGAACCACTCAGGTGCAGCCAGAGTGAGGTTTAGGAAGATTTTCATAAAGTCATATTTCATGTCAAAGGAAATCAGCAGTGATAGATGAAGGGTTCGCAGCGAGAGTCCCGGACTTGTCTAGAAATGAGCAGGTTTACAAGTACTGTTCTAAATGTTAACACCTGTTGCATTTATATTCTTTCCATTTGCTATCATGTCAGTGAACGCCAGGAGTGCTTTCTTTGCAACTTGTGTAACATTTTCTGTTTTTTCAGGTTTTACTGATGAGGCTTGTGAGGCCAATCAAAATAATGTTTGTGATCTCTACTACTGTTGATTTTGCCCTCGGAGCAAACTGAATAAAGCAACAAGATGAAAA