Transcript asmbl_27582

Sequence
Transcript Sequence for observation asmbl_27582 of TGE0008819:
CGAAATGTAGCGAAGAGAAGTACAGTAGTAAGAGTAACATTGTAGCCGTCGCCGGCCGAGGGGGTGCGCCGGGGAGGGGACGCCGCACCCCCCTTCTGCCGCAGGGACCCCCCGATCAAATCCCCAGAGGGAGGAGGCGCCCGAGGACCCGCCCCGGCCCCATCCACGTTCTCCCCAGGAAGCCGGACTCTATGGGGCGGGACCCTGGGGGAGACTGAGCAGAACCTGGAGCCAACCCCGAACCCCTGAACCTCGAGCCAGGGGCGCCCCAGGAGCACCCACTCTGTGGGTGCGCCGCCCACCCGCTGAGCAGCCATGAGCGAGACGGTTATCTGCTCCAGCCGGGCCACTGTGATGCTTTACGATGACGGCAACAAGCGGTGGCTGCCTGCTGGCACCGGCCCCCAGGCCTTCAGCCGAGTCCAGATCTACCACAACCCCACAGCCAATTCCTTCCGCGTGGTCGGCCGGAAAATGCAGCCGGACCAGCAGGTGGTCATCAACTGTGCCATCATCCGGGGTCTCAAGTACAACCAGGCCACCCCCAACTTCCACCAGTGGCGCGACGCCCGCCAGGTCTGGGGCCTCAACTTCGGCAGCAAGGAGGACGCCGCCCAGTTTGCCGCGGGCATGGCCAGCGCCCTCGAGGCCTTGGAAGGAGGTGGGCCTCCAGCAGCACCACCGCCACCTCAGCCACCTGCGGGGCCTCCTACCTGGTCTGTCCAGAACGGTCCCTCCCCGGAGGAGGCGGAGCAGCACAAAAGGCAGCCGGAGCACATGGAGCGGGAGCGCCGGGTCTCCAATGCAGGTGACTGCTCACATGGCCTCAGGAATCGGGGGGACCTCCCCGGAGGAGGGGCTGGCCCGGTGAGACGAC