Transcript asmbl_78798

Sequence
Transcript Sequence for observation asmbl_78798 of TGE0056843:
CGTCCTCCCCCGGAGAATACGACCTTTCGGCCATGTTAGCCAGGAGCGAGGGGCAGGGCTAAGGGGCCGGCGGCCACTCGGCATCTGGGTTTTAGTCAGGCAGTGCTCCAGGCGCCTGGCTGCCAGGCTACGGGAGAAAAGTCCTCCGCTCGGCCGCACCCGTTAGAGGCGCTCTCCACTGCTGTCCTCTTCAGCTCAAGATGGTGGCCTGCCGGGCGATTGGCATCCTCAGCCGCTTTTCTGCCTTCAGGATCCTCCGCTCCCGAGGTTATATATGCCGCAATTTTACAGGGTCTTCTGCTTTGCTGACCAGAACCCATATTAACTATGGAGTCAAAGGGGATGTGGCAGTTGTTCGAATTAACTCTCCCAATTCAAAGGTAAATACACTGAGTAAAGAGCTACATTCAGAGTTCTCAGAAGTTATGAATGAAATCTGGGCTAGTGATCAAATCAGAAGTGCCGTCCTTATCTCATCAAAGCCAGGCTGCTTTATTGCAGGTGCTGATATCAACATGTTAGCCGCTTGCAAGACCCTTCAAGAAGTAACACAGCTATCACAAGAAGCACAGAGAATAGTTGAGAAACTTGAAAAGTCCACAAAGCCTATTGTGGCTGCCATCAATGGATCCTGCCTGGGAGGAGGACTTGAGGTTGCCATTTCATGCCAATACAGAATAGCAACAAAAGACAGAAAAACAGTATTAGGTACCCCTGAAGTTTTGCTGGGGGCCTTACCAGGAGCAGGAGGCACACAAAGGCTGCCCAAAATGGTGGGTGTGCCTGCTGCTTTGGACATGATGCTGACTGGTAGAAGCATTCGTGCAGACAGGGCAAAGAAAATGGGACTGGTTGACCAACTGGTGGAACCCCTGGGACCAGGACTAAAACCTCCAGAGGAACGGACAATAGAATACCTAGAAGAAGTTGCAATTACTTTTGCCAAAGGACTAGCTGATAAGAAGATCTCTCCAAAGAGAGACAAGGGATTGGTGGAAAAATTGACAGCGTATGCCATGACTATTCCATTTGTCAGGCAACAGGTTTACAAAAAAGTGGAAGAAAAAGTGCGAAAGCAGACTAAAGGCCTTTATCCTGCACCTCTGAAAATAATTGATGTGGTAAAGACTGGAATTGAGCAAGGGAGTGATGCCGGTTATCTCTGTGAATCTCAGAAATTTGGAGAGCTTGTAATGACCAAAGAATCAAAGGCCTTGATGGGACTCTACCATGGTCAGGTCCTGTGCAAGAAGAATAAATTTGGAGCTCCACAGAAGGATGTTAAGCATCTGGCTATTCTTGGTGCAGGGCTGATGGGAGCAGGCATCGCCCAAGTCTCCGTGGATAAGGGGCTAAAGACTATACTTAAAGATGCCACCCTCACTGCGCTAGACCGAGGACAGCAACAAGTGTTCAAAGGATTGAATGACAAAGTGAAGAAGAAAGCTCTAACATCATTTGAAAGGGATTCCATCTTCAGCAACTTGACTGGGCAGCTTGATTACCAAGGTTTTGAAAAGGCCGACATGGTGATTGAAGCTGTGTTTGAGGACCTTAGTCTTAAGCACAGAGTGCTAAAGGAAGTAGAAGCGGTGATTCCAGATCACTGTATCTTTGCCAGTAACACATCTGCTCTCCCAATCAGTGAAATCGCTGCTGTCAGCAAAAGACCTGAGAAGGTGATTGGCATGCACTACTTCTCTCCCGTGGACAAGATGCAGCTGCTGGAGATTATCACGACCGAGAAAACTTCCAAAGACACCAGTGCTTCAGCTGTAGCAGTTGGTCTCAAGCAGGGGAAGGTCATCATTGTGGTTAAGGATGGACCTGGCTTCTATACTACCAGGTGTCTTGCGCCCATGATGTCTGAAGTCATCCGAATCCTCCAGGAAGGAGTTGACCCGAAGAAGCTGGATTCCCTGACCACAAGCTTTGGCTTTCCTGTGGGTGCCGCCACACTGGTGGATGAAGTTGGTGTGGATGTAGCGAAACATGTGGCGGAAGATCTGGGCAAAGTCTTTGGGGAGCGGTTTGGAGGTGGAAACCCAGAACTGCTGACACAGATGGTGTCCAAGGGCTTCCTAGGTCGTAAATCTGGGAAGGGCTTTTACATCTATCAGGAGGGTGTGAAGAGGAAGGATTTGAATTCTGACATGGATAGTATTTTAGCGAGTCTGAAGCTGCCTCCTAAGTCTGAAGTCTCATCAGACGAAGACATCCAGTTCCGCCTGGTGACAAGATTTGTGAATGAGGCAGTCATGTGCCTGCAAGAGGGGATCTTGGCCACACCTGCAGAGGGAGACATCGGAGCCGTCTTTGGGCTTGGCTTCCCGCCTTGTCTGGGAGGGCCTTTCCGCTTTGTGGATCTGTATGGCGCCCAGAAGATAGTGGACCGGCTCAAGAAATATGAAGCTGCCTATGGAAAACAGTTCACCCCATGCCAGCTGCTAGCTGACCATGCTAACAGCCCTAACAAGAAGTTCTACCAGTGAGCAGGCCTCATGCCTCGCTCAGTCAGTGCACTAACCCCAGCTGCCGGCAGTGCTGGTTCTCCAACAGAGTGGTGTCTAGATTTATCAGAGTAACGAGAAGACAAACTCCGGCACTGGGTTTGCTCCCTGATTAAAGTGCCTTCAGCCAAGACCATCTCTCCCTCCTGGTGAAGTGTGACTTCGAATTAGTTTGCACTTCCTGTTGGAAGGTAGAGCCCACTGCTCATTGTATAAGCCCCGAGGCCTAGAGTGGCAGCCAAGAGCCATCTGAAGCCACCTCTCTGCCTGTTCCTCCCAAGAGGCCAGGGTGGCCAGGGGTGGTGAGGGCAGTTCTGCACCCAGCCAAACACATAACAATAAAAACCAAACTCTGTGTCAGCATCTTTGCCCTTCTGGTTTAAACGCCTCCTTCAAAAAGCAATCTGGAAGAAAGCCCTGTGCTTTGGGGGAGTAAGAATGTGTGTGCAGAATTCTAGGCAGCACCTTAGGGAGGGACTGGGATGAGAGAAAGTGGGACCTGGTGGGCTCAACCACACACACCTGTCTGTGCAGATGCTTTGCCCAGGCTTCTCACCACGGTGTACCGGGATATTAAACCTCTTTCCCCAGCCTGG