Transcript asmbl_78715

Sequence
Transcript Sequence for observation asmbl_78715 of TGE0058463:
CCCGCGCGGCCGCCCCTCGGACCACCGGACTGGCCTGGGGCGGGACGTGGGCGCGGGGGCGCGGCGTGCGGCACGCTGCAGGGCTGAAGCGGCGGCGGCGGTGGGGACTGCACGTAGCCCGGCGCTCGGCATGGCTCTCCTGGTGCTCGGTCTGGTGAGCTGTACCTTCTTTCTGGCAGTGAATGGTCTGTATTCCTCTAGTGATGATGTGATCGAATTAACTCCATCGAATTTCAACCGAGAAGTTATTCAGAGTGATAGTTTGTGGCTTGTAGAATTCTATGCTCCATGGTGTGGTCACTGTCAAAGATTAACACCAGAATGGAAGAAAGCAGCAACTGCATTAAAAGATGTTGTCAAAGTTGGTGCAGTTGATGCAGATAAGCATCATTCCCTAGGAGGTCAGTATGGTGTTCAGGGATTTCCTACCATTAAGATTTTTGGATCCAACAAAAACAGACCAGAAGATTACCAAGGTGGCAGAACTGGTGAAGCCATTGTAGATGCTGCGCTGAGTGCTCTGCGCCAGCTCGTGAAGGATCGCCTCGGGGGACGGAGCGGAGGATACAGTTCTGGAAAACAAGGCAGAAGTGATAGTTCAAGTAAGAAGGATGTGATTGAGCTGACAGACGACAGCTTTGATAAGAATGTTCTGGACAGTGAAGATGTTTGGATGGTTGAGTTCTATGCTCCTTGGTGTGGACACTGCAAAAACCTAGAGCCAGAGTGGGCTGCCGCAGCTTCAGAAGTAAAAGAGCAGACGAAAGGAAAAGTGAAACTGGCAGCTGTGGATGCTACAGTCAATCAGGTTCTGGCCTCCCGATACGGGATTAGAGGATTTCCTACAATCAAGATATTTCAGAAAGGCGAGTCTCCTGTGGATTATGACGGTGGGCGGACAAGATCCGACATCGTGTCCCGGGCCCTTGATTTGTTTTCTGATAACGCCCCACCTCCTGAGCTGCTTGAGATTATCAACGAGGACATTGCCAAGAGGACGTGTGAGGAGCACCAGCTCTGTGTTGTGGCTGTGCTGCCCCATATCCTTGATACTGGAGCTGCAGGCAGAAATTCTTATCTGGAAGTTCTTCTGAAGTTGGCAGACAAATACAAAAAGAAAATGTGGGGGTGGCTGTGGACAGAAGCTGGAGCCCAGTCTGAACTTGAGACCGCGTTGGGGATTGGAGGGTTTGGGTACCCCGCCATGGCCGCCATCAATGCACGCAAGATGAAATTTGCTCTGCTAAAAGGCTCCTTCAGTGAGCAAGGCATCAACGAGTTTCTCAGGGAGCTCTCTTTTGGGCGTGGCTCCACGGCACCTGTAGGAGGCGGGGCTTTCCCTACCATCGTTGAGAGAGAGCCTTGGGACGGCAGGGATGGCGAGCTTCCCGTGGAGGATGACATTGACCTCAGTGATGTGGAGCTTGATGACTTAGGGAAAGATGAGTTGTGAGAGCCACAACAGAGGCTTCAGACCATTTTCTTTTCTTGGGAGCCAGTGGATTTTTCCAGCAGTGAAGGGACATTCTCTACACTCAGATGACTCTACCAGTGGCCTTTTAACCAAGAAGTAGTACTTGATTGGTCATTTGAAAACACTGCAACAGTGAACTTTTGCATCTCAAGAAAACATTGAAAAATTCTATGAATTGTTGTAGCCGGTGAATTGAGTCGTATTCTGTCACATAATATTTTGAAGAAAACTTGGCTGTCGAAACATTTTTCTCTCTGACTGCTGCTTGAATGTTCTTGGAGGCTGTTTCTTATGTATGGGTTTTTTTTAATGTGATCCCTTCATTTGAATATTAATGGCTTTTTCCATTAAAGAATAAAATATTTTGGACAATGCCGATAAATGTATGAAGTTAGTATCCACATCATAAATTCAGAGTGATGTTTAGCAGTAAATCAATATTTTGAAGTGATACACAGATGTCTTTCCTCCCCACAAACTTTTTTAAACAAAAAACAAGACCTCTTTTCTTTAGATGGTGCCACCTATGCCCACCACAACAGAGATTTTACATGGAAACCGGGCTCAGTGAGAACTGATTTCCTGCCCAATATTTGTCTTTGGGCTGTCTCTAGTGACTAATTATTAAGGAATCTAGCTGGTTATACAGTTCAAGGCTTTCTATGTTGTTAATGAACCTCAAAATAGCCGTTAAGACATGAAATACAGCAGCAGGTTACCAATGCGAACAGGTAGTTCGCATTTATGTAAAACATTCAGAAAATGAAGTTTTGAATTTGTTGGAACATTCAAAGGACTTGAGAGCATTTTATTGTAACTTAAAAAAATAAATACAACTGTCACTA