Transcript asmbl_78342

Sequence
Transcript Sequence for observation asmbl_78342 of TGE0056297:
GGTGCGCTTCCTGGAGCAGCAGAACGCGGCGCTCGCCGCCGAAGTGAACCGGCTCAAGGGCCGCGAGCCGACGCGAGTGGCCGAGCTCTACGAGGAGGAGCTGCGGGAGCTGCGGCGCCAGGTGGAGGTGCTCACTAACCAGCGCGCGCGCGTCGACGTCGAGCGCGACAACCTGCTCGACGACCTGCAGCGGCTCAAGGCCAAGCTGCAGGAGGAGATTCAGTTGAAGGAAGAAGCAGAGAACAATTTGGCTGCCTTCCGAGCGGACGTGGATGCAGCTACTCTAGCTCGCATTGACCTGGAGCGCAGAATTGAATCTCTCAACGAGGAGATCGCGTTCCTTAAGAAAGTGCATGAAGAGGAGATCCGTGAGTTGCAGGCTCAGCTTCAGGAACAGCAGGTCCAGGTGGAGATGGACATGTCTAAGCCAGACCTCACTGCCGCCCTCAGGGACATCCGGGCTCAGTATGAGACCATCGCGGCTAAGAACATTTCTGAAGCTGAGGAGTGGTACAAGTCGAAGGTGTCAGACCTGACCCAGGCAGCCAACAAGAACAACGACGCCCTGCGCCAGGCCAAGCAGGAGATGATGGAATACCGACACCAGATCCAGTCCTACACCTGCGAGATTGACGCCCTGAAGGGCACTAACGATTCCCTGATGAGGCAGATGCGGGAATTGGAGGACCGATTTGCCAGTGAGGCCAGTGGCTACCAGGACAACATTGCGCGCCTGGAGGAGGAAATCCGGCACCTCAAGGATGAGATGGCCCGCCATCTGCGCGAGTACCAGGACCTGCTCAACGTGAAGATGGCCCTGGATGTGGAGATTGCCACCTACCGGAAGCTGCTGGAGGGAGAGGAGAGCCGGATCAATCTCCCCATCCAGACCTACTCTGCCCTCAACTTCCGAGAAACCAGCCCTGAGCAAAGGGGTTCTGAGGTCCATACCAAGAAGACGGTGATGATCAAGACCATCGAGACACGGGATGGGGAGGTCGTCAGTGAGGCCACACAGCAGCAGCATGAAGTGCTCTAAAGACAGAGACCCTCTGCCACCAGAGACCGTCCTCACCCCTGTCCTCACTGCTCCCTGAAGCCAGCCTTCTTCCATCCCAGGACACCACACCCAGCCTCAGTCCTCCCCTCACAGCCTCTGACCCCTCCTCACTGGCCATCCCTCGTGGTCCCCAACAGCGACATAGCCCATCCCTGCCTGGTCACAGGGCATGCCCCGGCCACCTCTGCGGACCCCAGCTGTGAGCCTTGGCTGTTGGCAGTGAGTGAGCCTGGCTCTTGTGCTGGATGGAGCCCAGGCGGGAGCGGTGGCCCTGTCCCTCCCACCTCTGTGACCTCAGGCACTAGCCTTTGGCTCTGGAGACAGCCCCAGAGCAGGGTGTTGGGATACTGCAGGGCCAGGACTGAGCCCCGCAGACCTCCCCAGCCCCTAGCCCAGGAGAGAGAAAGCCAGGCAGGTAGCCAGGGGGACTAGCCCCTGTGGAGACTGGGGGGCTTGAAATTGTCCCCGTGGTCTCTTACTTTCCTTTCCCCAGCCCAGGGTGGACTTAGAAAGCAGGGGCTACAAGAGGGAATCCCCGAAGGTGCTGGAGGTGGGAGCAGGAGATTGAGAAGGAGAGAAAGTGGGTGAGATGCTGGAGAAGAGAGGAGAGGAGAGAGGCAGAGAGCGGTCTCAGGCTGGTGGGAGGGGCGCCCACCTCCCCACGCCCTCCCCTCCCCTGCTGCAGGGGCTCTGGAGAGAAACAATAAAGAGATTCACACACAAGCCA