Transcript asmbl_78276

Sequence
Transcript Sequence for observation asmbl_78276 of TGE0057402:
CCGCCCCTTTCAGGCCTAGCAGGAAACGAAGCGGCTCTTTCCGCTATCTGCCGCTTGTCCACCGGAAGCGAGTTGCGACACGGCAGGTTCCCGCCCGGAAGAAGCGACCAAAGCGCCTGAGGACCGGCAACATGGTGCGGTCGGGGAATAAGGCAGCTGTTGTGCTGTGTATGGACGTGGGCTTTACCATGAGTAACTCCATTCCTGGTATAGAATCCCCATTTGAACAAGCAAAGAAGGTGATAACCATGTTTGTACAGCGACAGGTGTTTGCTGAGAACAAGGATGAGATTGCTTTAGTCCTGTTTGGTACAGATGGCACTGACAATCCCCTTTCTGGTGGGGATCAGTATCAGAACATCACAGTGCACAGACATCTGATGCTACCAGATTTTGATTTGCTGGAGGACATTGAAAGCAAAATCCAACCAGGTTCTCAACAGGCTGACTTCCTGGATGCACTAATCGTGAGCATGGATGTGATTCAACATGAAACAATAGGAAAGAAGTTTGAGAAGAGGCATATTGAAATATTCACTGACCTCAGCAGCCGATTCAGCAAAAGTCAGCTGGATATTATAATTCATAGCTTGAAGAAATGTGACATCTCCCTGCAATTCTTCTTGCCTTTCTCACTTGGCAAGGAAGATGGAAGTGGGGACAGAGGAGATGGCCCCTTTCGCTTAGGTGGCCATGGGCCTTCCTTTCCACTAAAAGGAATTACCGAACAGCAAAAAGAAGGTCTTGAGATAGTGAAAATGGTGATGATATCTTTAGAAGGTGAAGATGGGTTGGATGAAATTTATTCATTCAGTGAGAGTCTGAGAAAACTGTGCGTCTTCAAGAAAATTGAGAGGCATTCCATTCACTGGCCCTGCCGACTGACCATTGGCTCCAATTTGTCTATAAGGATTGCAGCCTATAAATCGATTCTACAGGAGAGAGTTAAAAAGACTTGGACAGTTGTGGATGCAAAAACCCTAAAAAAAGAAGATATACAAAAAGAAACAGTTTATTGCTTAAATGATGATGATGAAACTGAAGTTTTAAAAGAGGATATTATTCAAGGGTTCCGCTATGGAAGTGATATAGTTCCTTTCTCTAAAGTGGATGAGGAACAAATGAAATATAAATCGGAGGGGAAGTGCTTCTCTGTTTTGGGATTTTGTAAATCTTCTCAGGTTCAGAGAAGATTCTTCATGGGAAATCAAGTTCTAAAGGTCTTTGCAGCAAGAGATGATGAGGCAGCTGCAGTTGCACTTTCCTCCCTGATTCATGCTTTGGATGACTTAGACATGGTGGCCATAGTTCGATATGCTTATGACAAAAGAGCTAATCCTCAAGTCGGCGTGGCTTTTCCTCATATCAAGCATAACTATGAGTGTTTAGTGTATGTGCAGCTGCCTTTCATGGAAGACTTGCGGCAATACATGTTTTCATCCTTGAAAAACAGTAAGAAATATGCTCCCACCGAGGCACAGTTGAATGCTGTTGATGCTTTGATTGACTCCATGAGCTTGGCAAAGAAAGATGAGAAGACAGACACCCTTGAAGACTTGTTTCCAACCACCAAAATCCCAAATCCTCGATTTCAGAGATTATTTCAGTGTCTGCTGCACAGAGCTTTACATCCCCGGGAGCCTCTACCCCCAATTCAGCAGCATATTTGGAATATGCTGAATCCTCCCGCTGAGGTGACAACAAAAAGTCAGATTCCTCTCTCTAAAATAAAGACCCTTTTTCCTCTGATTGAAGCCAAGAAAAAGGATCAAGTGACTGCTCAGGAAATTTTCCAAGACAACCATGAAGATGGACCTACAGCTAAAAAATTAAAGACTGAGCAAGGGGGAGCCCACTTCAGCGTCTCCAGTCTGGCTGAAGGCAGTGTCACCTCTGTTGGAAGTGTGAATCCTGCTGAAAACTTCCGTGTTCTAGTGAAACAGAAGAAGGCCAGCTTTGAGGAAGCGAGTAACCAGCTCATAAATCACATCGAACAGTTTTTGGATACTAATGAAACACCGTATTTTATGAAGAGCATAGACTGCATCCGAGCCTTCCGGGAAGAAGCCATTAAGTTTTCAGAAGAGCAGCGCTTTAACAACTTCCTGAAAGCCCTTCAAGAGAAAGTGGAAATTAAACAATTAAATCATTTCTGGGAAATTGTTGTCCAGGATGGAATTACTCTGATCACCAAAGAGGAAGCCTCTGGAAGTTCTGTCACAGCTGAGGAAGCCAAAAAGTTTCTGGCCCCCAAAGACAAACCAAGTGGAGACACAGCAGCTGTATTTGAAGAAGGTGGTGATGTGGACGATTTATTGGACATGATATAGGTCGTGGATGTATGGGGAATCTAAGAGAGCTGCCATCGCTGTGATGCTGGGAGTTCTAACAAAACAAGTTGGATGCGGCCATTCAAGGGGAGCCAAAATCTCAAGAAATTCCCAGCAGGTTACCTGGAGGCGGATCATCTAATTCTCTGTGGAATGAATACACACATATATATTACAAGGGATAATTTAGACCCCATACAAGTTTATAAAGAGTCATTGTTATTTTCTGGTTGGTGTATTATTTTTTCTGTGGTCTTACTGATCTTTGTATATTACATACATGCTTTGAAGTTTCTGGAAAGTAGATCTTTTCTTGACCTAGTATATCAGTGACAGTTGCAGCCCTTGTGATGTGATTAGTGTCTCATGTGGAACCATGGCATGGTTATTGATGAGTTTCTTAACCCTTTCCAGAGTCCTCCTTTGCCTGATCCTCCAACAGCTGTCACAACTTGTGTTGAGCAAGCAGTAGCATTTGCTTCCTCCCAACAAGCAGCTGGGTTAGGAAAACCATGGGTAAGGACGGACTCACTTCTCTTTTTAGTTGAGGCCTTCTAGTTACCACATTACTCTGCCTCTGTATATAGGTGGTTTTCTTTAAGTGGGGTGGGAAGGGGAGCACAATTTCCCTTCATACTCCTTTTAAGCAGTGAGTTATGGTGGTGGTCTCATGAAGAAAAGACCTTTTGGCCCAATCTCTGCCATATCAGTGAACCTTTAGAAACTCAAAAACTGAGAAATTTACTACAGTAGTTAGAATTATATCACTTCACTGTTCTCTACTTGCAAGCCTCAAAGAGAGAAAGTTTCGTTATATTAAAACACTTAGGTAACTTTTCGGTCTTTCCCATTTCTACCTAAGTCAGCTTTCATCTTTGTGGATGGTGTCTCCTTTACTAAATAAGAAAATAACAAAGCCCTTATTCTCTTTTTTTCTTGTCCTCATTCTTGCCTTGAGTTCCAGTTCCTCTTTGGTGTACAGACTTCTTGGTACCCAGTCACCTCTGTCTTCAGCACCCTCATAAGTCGTCACTAATACACAGTTTTGTACATGTAACATTAAAGGCATAAATGACTCATCTCTCTGTGAATTGCTGCTAATTATTGTCTGCAAAAGACTTCTTCAGTGCTCTGCTGAGAATTGAACACCCTTATCCATTGATTGAAAATGGATCTGCAAGATAGAACATCATTCATTTAGCTGAGGAGAGAAAGGAGTGCTTTACTTTGGGCTTCTAGGACATCCTCTCAATACTATACACACTTGCATCAAACTTGACATACAGGTGCTCATTTAAAGTAACCCCAACAGAGGATGACATATAGTTTCTGGTTAGATAGTTAAAGCCCAGGGGTTGTTTGTGACTTGGACAAAACTGAGACATTCTTAGAACCACAGAGAGTGGAAACTTTGATCTCTGAAATCTTCATTATTCTCATCAGATCCTCCCAGCAATATGAATCAGCTCAGTAAGTATGGCTCCATCAGCAGCCCCTGTCTTTGGCAGTTTGGGGAATTTCTTTTGGGAAACGTCAGTCTTTTTGTCATGCCAGGAAAAGTTTAAATCAAGTTAGTCCTTTAGATCTTCTGATACTTTTTGACTTAGTTTGAATGCAGCAGGATTATTTGTGCTTCTCTAACCCTGTTTTACCTAAATCTCAATACCTCAAGGAAGAAATTAGTTTCACAGGCTAAGGAGAGGAAGAACTAAATGAGTCATGTAATTTCCAAATCCATTTCATACAGGTGAAGTATATGTGCTATGTAGACTTCATCAGAGCGTACTGTTTTGAGTAGGGACAGCGTGTTTTGCATGAACACATCACAGTCCCATTTCCGTGAAATGAGATTGGCAGATCTACAGAACTCCCAGGTGTTCTGCTGAGTGTAGCCCTGGAGGACAGCAAGTGCTGTATTGTCGTCAATCCACCATGGGCTGCTTCTCAGAAGCCCAGTAATCCCACAAATGATAGGCTTGTCTGTGATTGCAAGTCACTGACTATGGACCCGGTCACCTTTTTCTTCTATGTCACTGAAATTTATTGACTTGAAGAGGAGTCATCCTCTTTGTGACCCCCCCACCCAAGTCACAACTCAAATGACCATACGCATTTCCAAATGCCCCCTTGAAGGTATGTGCTGCCCCTCATTAAGTACCACTATTTTAAATGTTGGGTTTTAATCCTTTGCCAGTTAATTTACATATAAGATTTAGAATCTTGGAAAACTATTTGAAAAATCGTGTTGGGATTAGGCAGCATTTTTTTTTCCCGCCAAGTCCAGGATGGCTTTGAAAATAAATGGACACAGATCTCTCCTGTTTTGATGATGTGCAGTGCTAATGACTGGCTTTGCAGTTAATTTTGATTCAGGCAACAGATGTTCCTTTTGGTTCCCTGTCTCCCATGGGCGTCATTTCATGTTGTCCTCTGCCTTCCCCCAGATATTCTAAGTTCAGGACACAAGCTTGTGGCCCATGCAGAGCAGAGGCCATGAGGGGTCACAGCATGGGTACGGGAGGAAACACTGGGCTAACCCAGATACTGGACTTGAGTCTTGCCTCTGCTGCTTGCTGCACAGCTTCTGTCATGGTGCTAAACCTGTGACCTGCCTCACAGGCTTAGAGCATGCCCGTAGAAGTACTCTAAACTAAAATGCTTTCCACAAATGAGATGGTTTCATGAAAACTTCAAATAGAGGGCCTGGGCAGAACATAACCTT