Transcript asmbl_78226

Sequence
Transcript Sequence for observation asmbl_78226 of TGE0001324:
CCCCAGCCTCGAGGCCGGGCGTCTTCGGTCATCTCCGGCGCTTCTAGGGCTGGTTCCCGTCATCTTCGGGAGCCGTGGAGGTACGAACTTAAGACATGCCTATTTTATTAATTTACTTCCAAACGCAACGAAAGGTCCATGGACAATTTGTGGGCCATTTAATTCAGGGCCCCCAATTCGTACGTGGAGAAGTGGGAATGCAAAAGTACTTTGACCTTTAACCTTCGGTCCGGCGCGGTGGAGGGAAACGCCTCCGTCTCTATATAAGGAATTTTCCGGTCTCTTCGGGTCCTTTTTCCTCTCTTCAGCGTGGGGCGCCCACAATTTGCGCGCTCTCTTTCTGCTGCTCCCCAGCTCTCGGATACAGCCGACACCATGGGTTTCGGAGACCTGAAAAGCCCTGCCGGCCTCCAGGTGCTCAACGATTACCTGGCGGACAAGAGCTACATCGAGGGGTATGTGCCATCACAAGCAGATGTGGCAGTATTTGAAGCCGTGTCCAGCCCACCGCCTGCCGACTTGTGTCATGCCCTACGTTGGTATAATCACATCAAGTCTTACGAAAAGGAAAAGGCCAGCCTGCCAGGAGTGAAGAAAGCTTTGGGCAAATATGGTCCTGCCGATGTGGAAGACACTACAGGAAGTGGAGCTACAGATAGTAAAGATGATGATGACATTGACCTCTTTGGATCTGATGATGAGGAGGAAAGTGAAGAAGCAAAGAGGCTAAGGGAAGAACGTCTTGCACAATATGAATCAAAGAAAGCCAAAAAACCTGCACTTGTTGCCAAGTCTTCCATCTTACTAGATGTGAAACCTTGGGATGATGAGACAGATATGGCGAAATTAGAGGAGTGCGTCAGAAGCATTCAAGCAGACGGCTTAGTCTGGGGCTCATCTAAACTAGTTCCAGTGGGATACGGAATTAAGAAACTTCAAATACAGTGTGTAGTTGAAGATGATAAAGTTGGAACAGATATGCTGGAGGAGCAGATCACTGCTTTTGAGGACTATGTGCAGTCCATGGATGTGGCTGCTTTCAACAAGATCTAAAATCCATCCTGGATCATGGCATTTAAATAAAAGATTGAAAGA