Transcript asmbl_78070

Sequence
Transcript Sequence for observation asmbl_78070 of TGE0059673:
GGGATGGGTGCGGCTCTCATATTTCAGAAAGGGGCTGGAAAGTGAGGGAAGCCAAACTTTTTCCTATTTAAGGCCAAAGCAAAGGAATCTCAGTGGCTGAGTTTTATGACGGGCCCGGTGCTGAAGGGCAGGGAACAACTTGATGGTGCTACTTTGAACTGCTTTTCTTTTCTCCTTTTTGCACAAAGAGTCTCATGTCTGATATTTAGACATGATGAGCTTTGTGCAAAAGGGGAGCTGGCTACTTCTCGCTCTGCTTCATCCCACTATTATTTTGGCACAACAGGAAGCTGTTGAAGGAGGATGTTCCCATCTTGGTCAGTCCTATGCGGATAGAGATGTCTGGAAGCCAGAACCATGCCAAATATGTGTCTGTGACTCAGGATCCGTTCTCTGCGATGACATAATATGTGACGATCAAGAATTAGACTGCCCCAACCCAGAAATTCCATTTGGAGAATGTTGTGCAGTTTGCCCACAGCCTCCAACTGCTCCTACTCGCCCTCCTAATGGTCAAGGACCTCAAGGCCCCAAGGGAGATCCAGGCCCTCCTGGTATTCCTGGGAGAAATGGTGACCCTGGTATTCCAGGACAACCAGGGTCCCCTGGTTCTCCTGGCCCCCCTGGAATCTGTGAATCATGCCCTACTGGTCCTCAGAACTATTCTCCCCAGTATGATTCATATGATGTCAAGTCTGGAGTAGCAGTAGGAGGACTCGCAGGCTATCCTGGACCAGCTGGCCCCCCAGGCCCTCCCGGTCCCCCTGGTACATCTGGTCATCCTGGTTCCCCTGGATCTCCAGGATACCAAGGACCCCCTGGTGAACCTGGGCAAGCTGGTCCTTCAGGCCCTCCAGGACCTCCTGGTGCTATAGGTCCATCTGGTCCTGCTGGAAAAGATGGAGAATCAGGTAGACCCGGACGACCTGGAGAGCGAGGATTGCCTGGACCTCCAGGTATCAAAGGTCCAGCTGGGATACCTGGATTCCCTGGTATGAAAGGACACAGAGGCTTCGATGGACGAAATGGAGAAAAGGGTGAAACAGGTGCTCCTGGATTAAAGGGTGAAAATGGTCTTCCAGGCGAAAATGGAGCTCCTGGACCCATGGGTCCAAGAGGGGCTCCTGGTGAGCGAGGACGGCCAGGACTTCCTGGGGCTGCAGGTGCTCGGGGTAATGACGGTGCTCGAGGCAGTGATGGTCAACCAGGCCCTCCTGGTCCTCCTGGAACTGCCGGATTCCCTGGATCCCCTGGTGCTAAGGGTGAAGTTGGACCTGCAGGGTCTCCTGGTTCAAATGGTGCCCCTGGACAAAGAGGAGAACCTGGACCTCAGGGACACGCTGGTGCTCAAGGTCCTCCTGGCCCTCCTGGGATTAATGGTAGTCCTGGTGGTAAAGGCGAAATGGGTCCCGCTGGCATTCCTGGAGCTCCTGGACTGATGGGAGCCCGGGGTCCTCCAGGACCAGCCGGTGCTAATGGTGCTCCTGGACTGCGAGGTGGTGCAGGTGAGCCTGGTAAGAATGGTGCCAAAGGAGAGCCCGGACCACGTGGTGAACGCGGTGAGGCTGGTATTCCAGGTGTTCCAGGAGCTAAAGGCGAAGATGGCAAGGATGGATCACCTGGAGAACCTGGTGCAAATGGGCTTCCAGGAGCTGCAGGAGAAAGGGGTGCCCCTGGGTTCCGAGGACCTGCTGGACCAAATGGCATCCCAGGAGAAAAGGGTCCTGCTGGAGAGCGTGGTGCTCCAGGCCCTGCAGGGCCCAGAGGAGCTGCTGGAGAACCTGGCAGAGATGGCGTCCCTGGAGGTCCAGGAATGAGGGGCATGCCCGGAAGTCCAGGAGGACCAGGAAGTGATGGGAAACCAGGGCCTCCCGGAAGTCAAGGAGAAAGTGGTCGACCAGGTCCTCCTGGGCCATCTGGTCCCCGAGGTCAGCCTGGTGTCATGGGCTTCCCCGGTCCTAAAGGAAATGATGGTGCTCCTGGTAAGAATGGAGAACGAGGTGGCCCTGGAGGACCTGGCCCTCAGGGTCCTCCTGGAAAGAATGGTGAAACTGGACCTCAGGGACCCCCAGGGCCTACTGGGCCTGGTGGTGACAAAGGAGACACAGGACCCCCTGGTCCACAAGGATTACAAGGCTTGCCTGGTACAGGTGGTCCTCCAGGAGAAAATGGAAAACCTGGGGAACCAGGTCCAAAGGGTGATGCCGGTGCACCTGGAGCTCCAGGAGGCAAGGGTGATGCTGGTGCCCCTGGTGAACGTGGACCTCCTGGATTGGCAGGGGCCCCAGGACTTAGAGGTGGAGCTGGTCCCCCTGGTCCCGAAGGAGGAAAGGGTGCTGCTGGTCCTCCTGGGCCACCTGGTGCTGCTGGTACTCCTGGTCTGCAAGGAATGCCTGGAGAAAGAGGAGGTCTTGGAAGTCCTGGTCCAAAGGGTGACAAGGGTGAACCAGGCGGTCCAGGTGCTGATGGTGTCCCAGGGAAAGATGGCCCAAGGGGTCCTACTGGTCCTATTGGTCCTCCTGGCCCAGCTGGCCAGCCTGGAGATAAGGGTGAAGGTGGTGCCCCCGGACTTCCAGGTATAGCTGGACCTCGTGGTAGCCCTGGTGAGAGAGGTGAAACTGGCCCTCCAGGACCTGCTGGTTTCCCTGGTGCTCCTGTAAGTGTGAATATTTATACATACATGTCCCATAGCCCAGGATCTCTATCTTGCTGAAAAATTACAAAAGTATAGTCAAGTTTGGTTTCTAGTCTCATTTTAGCTGCTCATTCCCTATAGGATTATTGTACCCCTATTTTGTTTTACTTTACCCCTATTGTCGCTCTTTGAAAGATGGAAATAAAAACACCTGTCCTGCTTTTATGACTGGGTAATGAACTAAAGCAGTATCATGGATTTAAAAGCACTCTGAATTTTTGTAAATTCTTCCATTATAAGATGGTACTAATTAAAATTTTCTCTTAAATCCGGTCTTTCTCAAAAAAATTTACTGGTGCTGATTTTCAAATGTTTAATCCTTAGAGACACTTCCTCCCTCCCTAATGGCAAATAATGCACAGTTTATGCTTTCTTGGTCATGTTCTTTGATCATGAAAATATTTTGATTGGCTTCATTTTGTCATGTCTTCAGAAAGCCTTGTTTTTAAATTTTATTTCAACTCCTTCCATCTGAAGAATTCTATATTCTGAAGAGAAATAATAATAAGCCAATTGTATCATAAAGAGTGTCAGCTGAGAGATTGCTGTTGTTGTTGCATGTAGGGACAGAATGGTGAACCTGGTGGTAAAGGAGAAAGAGGGGCTCCGGGTGAGAAAGGTGAAGGAGGCCCTCCTGGAGTTGCAGGACCCCCTGGAGGTTCTGGACCTGCTGGTCCTCCTGGTCCCCAAGGTGTCAAAGGTGAACGTGGCAGTCCTGGTGGACCTGGTGCTGCTGGCTTCCCTGGTGCTCGTGGTCTTCCTGGTCCTCCTGGTAGTAATGGTAACCCAGGACCCCCAGGTCCCAGCGGTTCTCCAGGCAAGGATGGGCCCCCAGGTCCTGCGGGTAACACTGGTGCTCCTGGCAGCCCTGGAGTGTCTGGACCAAAAGGTGATGCTGGCCAACCAGGAGAGAAGGGATCGCCTGGTGCCCAGGGCCCACCAGGAGCTCCAGGCCCACTTGGGATTGCTGGGATCACTGGAGCACGGGGTCTTGCAGGACCACCAGGCATGCCAGGTCCTAGGGGAAGCCCTGGCCCTCAGGGTGTCAAGGGTGAAAGTGGGAAACCAGGAGCTAACGGTCTCAGTGGAGAACGTGGTCCCCCTGGACCCCAGGGTCTTCCTGGTCTGGCTGGTACAGCTGGTGAACCTGGAAGAGATGGAAACCCTGGATCAGATGGTCTTCCAGGCCGAGATGGATCTCCTGGTGGCAAGGGTGATCGTGGTGAAAATGGCTCTCCTGGTGCCCCTGGCGCTCCTGGTCATCCAGGCCCACCTGGTCCTGTCGGTCCAGCTGGAAAGAGTGGTGACAGAGGAGAAAGTGGCCCTGCTGGCCCTGCTGGTGCTCCCGGTCCTGCTGGTTCCCGAGGTGCTCCTGGTCCTCAAGGCCCACGTGGTGACAAAGGTGAAACAGGTGAACGTGGAGCTGCTGGCATCAAAGGACATCGAGGATTCCCTGGTAATCCAGGTGCCCCAGGTTCTCCAGGCCCTGCTGGTCAGCAGGGTGCAATCGGCAGTCCAGGACCTGCAGGCCCCAGAGGACCTGTTGGACCCAGTGGACCTCCTGGCAAAGATGGAACCAGTGGACATCCAGGTCCCATTGGACCACCAGGGCCTCGAGGTAACAGAGGTGAAAGAGGATCTGAGGGCTCCCCAGGCCACCCAGGGCAACCAGGCCCTCCTGGACCTCCTGGTGCCCCTGGTCCTTGCTGTGGTGGTGTTGGAGCCGCTGCCATTGCTGGGATTGGAGGTGAAAAAGCTGGCGGTTTTGCCCCGTATTATGGAGATGAACCAATGGATTTCAAAATCAACACCGATGAGATTATGACTTCACTCAAGTCTGTTAATGGACAAATAGAAAGCCTCATTAGTCCTGATGGTTCTCGTAAAAACCCCGCTAGAAACTGCAGAGACCTGAAATTCTGCCATCCTGAACTCAAGAGTGGAGAATACTGGGTTGACCCTAACCAAGGATGCAAATTGGATGCTATCAAGGTATTCTGTAATATGGAAACTGGGGAAACATGCATAAGTGCCAATCCTTTGAATGTTCCACGGAAACACTGGTGGACAGATTCTAGTGCTGAGAAGAAACACGTTTGGTTTGGAGAGTCCATGGATGGTGGTTTTCAGTTTAGCTACGGCAATCCTGAACTTCCTGAAGATGTCCTTGATGTGCATCTGGCATTCCTTCGACTTCTCTCCAGCCGAGCTTCCCAGAACATCACATATCACTGCAAAAATAGCATTGCATACATGGATCAGGCCAGTGGAAATGTAAAGAAGGCCCTGAAGCTGATGGGGTCAAATGAAGGTGAATTCAAGGCTGAAGGAAATAGCAAATTCACCTACACAGTTCTGGAGGATGGTTGCACGAAACACACTGGGGAATGGAGCAAAACAGTCTTTGAATATCGAACACGCAAGGCTGTGAGACTACCTATTGTAGATATTGCACCCTATGACATTGGTGGTCCTGATCAAGAATTTGGTGTGGACGTTGGCCCTGTTTGCTTTTTATAAACCAAACTCTATCTGAAATCCCAACAAAAAAAATTTAACTCCATATGTGTTCCTCTTGTTCTAATCTTGTCAACCAGTGCAAGTGACCGACAAAATTCCAGTTATTTATTTCCAAAATGTTTGGAAACAGTATAATTTGACAAAGAAAAATGATACTTCTCTTTTTTTGCTGTTCCACCAAATACAATTCAAATGCTTTTTGTTTTATTTTTTTACCAATTCCAATTTCAAAATGTCTCAATGGTGCTATAATAAATAAACTTCAACACTCTTTATGATAACAACACTGTGTTATATTCTTTGAATCCTAGCCCATCTGCAGAGCAATGACTGTGCTCACCAGTAAAAGATAACCTTTCTTTCTGAAATAGTCAAATACGAAATTAGAAAAGCCCTCCCTATTTTAACTACCTCAACTGGTCAGAAACACAGATTGTATTCTATGAGTCCCAGAAGATGAAAAAAATTTTATACGTTGATAAAACTTATAAATTTCATTGATTAATCTCCTGGAAGATTGGTTTAAAAAGAAAAGTGTAATGCAAGAATTTAAAGAAATATTTTTAAAGCCACAATTATTTTAATATTGGATATCAACTGCTTGTAAAGGTGCTCCTCTTTTTTCTTGTCATTGCTGGTCAAGATTACTAATATTTGGGAAGGCTTTAAAGACGCATGTTATGGTGCTAATGTACTTTCACTTTTAAACTCTAGATCAGAATTGTTGACTTGCATTCAGAACATAAATGCACAAAATCTGTACATGTCTCCCATCAGAAAGATTCATTGGCATGCCACAGGGGATTCTCCTCCTTCATCCTGTAAAGGTCAACAATAAAAACCAAATTATGGGGCTGCTTTTGTCACACTAGCATAGAGAATGTGTTGAAATTTAACTTTGTAAGCTTGTATGTGGTTGTTGATCTTTTTTTTCCTTACAGACACCCATAATAAAATATCATATTAAAATTC