Transcript asmbl_77387

Sequence
Transcript Sequence for observation asmbl_77387 of TGE0058714:
AGCGGTGGGAGGACTGCGGGGCTCTTGAGGCCAGCTGCAGAGCTTGTGGAGGCCATGGGGCGCGTCGTCGCGGAGCTCGTCTCCTCGCTGCTGGGGTTGTGGCTGTTGCTGTGCAGCTGCGGATGCCCCGAGGGCGCCGAGCTGCGTGCTCCGCCAGATAAAATCGCGATTATTGGAGCCGGAATTGGTGGCACTTCAGCAGCCTATTACCTGCGGCAGAAATTTGGGAAAGATGTGAAGATAGACCTGTTTGAAAGAGAAGAGGTCGGGGGCCGCCTGGCTACCATGATGGTGCAGGGGCAAGAATACGAGGCAGGAGGTTCTGTCATCCATCCTTTAAATCTGCACATGAAACGTTTTGTCAAAGACCTGGGTCTCTCTGCTGTTCAGGCCTCTGGTGGCCTACTGGGGATATATAATGGAGAGACTCTGGTATTTGAGGAGAGCAACTGGTTCATAATTAACGTGATTAAATTAGTTTGGCGCTATGGATTTCAATCCCTCCGTATGCACATGTGGGTAGAGGACGTGTTAGACAAGTTCATGAGGATCTACCGCTACCAGTCTCATGACTATGCCTTCAGTAGTGTCGAAAAATTACTTCATGCTCTAGGAGGAGATGACTTCCTTGGAATGCTTAATCGAACACTTCTTGAAACCTTGCAAAAGGCCGGCTTTTCTGAGAAGTTCCTCAATGAAATGATTGCTCCTGTTATGAGGGTCAATTATGGCCAAAGCACGGACATCAATGCCTTTGTGGGGGCGGTGTCACTGTCCTGTTCTGATTCTGGCCTTTGGGCAGTAGAAGGTGGCAATAAACTTGTTTGCTCAGGGCTTCTGCAGGCATCCAAAAGCAATCTTATATCTGGCTCAGTAATGTACATCGAGGAGAAAACAAAGACCAAGTACACAGGAAATCCAACAAAGATGTATGAAGTGGTCTACCAAATTGGAACTGAGACTCGTTCAGACTTCTATGACATCGTCTTGGTGGCCACTCCGTTGAATCGAAAAATGTCGAATATTACTTTTCTCAACTTTGATCCTCCAATTGAGGAATTCCATCAATATTATCAACATATAGTGACAACTTTAGTTAAGGGGGAATTGAATACATCTATCTTTAGCTCTAGACCCATAGATAAATTTGGCCTTAATACAGTTTTAACCACTGATAATTCAGATTTGTTCATTAACAGTATTGGGATTGTGCCCTCTGTGAGAGAAAAGGAAGATCCTGAGCCATCAACAGATGGAACATATGTTTGGAAGATCTTTTCCCAAGAAACTCTTACTAAAGCACAAATTTTAAAGCTCTTTCTGTCCTATGATTATGCTGTGAAGAAGCCATGGCTTGCATATCCTCACTATAAGCCCCCGGAGAAATGCCCCTCTATCATTCTCCATGATCGACTTTATTACCTCAATGGCATAGAGTGTGCAGCAAGTGCCATGGAGATGAGTGCCATTGCAGCCCACAACGCTGCACTCCTTGCCTATCACCGCTGGAACGGGCACACAGACATGATTGATCAGGATGGCTTATATGAGAAACTTAAAACTGAACTATGAAGTGACACACTCCTTTTTCCCCTCCTAGTTCCAAATGACTATCAGTGGCAAAAAAGAACAAAATCTGAGCAGAGATGATTTTGAACCAGATATTTTGCCATTATCATTGTTTAATAAAAGTAATCCCTGCTGGTCATAGGAAAACACACGGTTCTAATTAAGTGTGAAGGTATAGCTATTGCACTTATGCCATCTCCAAAATTTCTTAAGTATTCTTTCACTATCCATTAGGAGTTTTTCTTAAACTTGTCTGATAATAAGAATCACCTGGAGTTAGGAGGTGGTGGTTGCAGTGAGCCAATCTCACCATTGCACTTCAGCCTGAGCAACACGAGCAAAACTCCGTCTCAAAAGTAAATAAAAATAATCACCTGGAGTTTGTTAAACCATATGGATTCTCAAGCTCCTCTCTTGAAGATTCTGATTCAGTAGGTCTGGGAGTGGCGCGCTGGATTTTGATCAAAATTGTAGAGCATTTTAAGGTGAGTACCTGAGGGAGAACTTAAAGACATCTTAGTTGGGGAGTAGTCCTTTTGAATTTTACAGCTAGATATAATCTTCAGTCAGATAAAATTTATGGGAGCTGGTGTCTTATGCCTGACTCTTAGTAATTTCATACCGGTTTGAAGTACGTGTGCCCATGCCTAAAGCCTTGACTTTCAGAATGTTGTCTTTTGATTCTTCTGTCTTGATTTGATTAGGGGTGAAATTTAGAAGTCTTAGTAATGTAACTTGAAGATGTTAAACAAAAATCTCAAGTAAAATGAAAAGCAAATATGGGCTACTGAATTAAGAAACTGGCATTCTAGTATTAAATCCTCACTTCAGGAGCTTTTAAAAATACTGAGACCCCCCCATAACCAGAGATTCAGATTCAAAGACTGAGGATAGGACCTTAGCATTGTAGCTATTTAAAGTTTCTAATGTGCACCCAGGGTTGGGAATCACCAATGTGGGTGTGAAAATGCCTACAAAGGGTTTTAGTGCCTTAGAAGTCCTAAGAAGCCCAATCTGTATCAAAGCAGATCCATTTTGCAAGGATCTTTCTTTTAGAACTTTCTCAGTTCTCTTAGTAAGAACTTTAGAAGTAATCTTGATAATAAGCACAGACAGCCTAACAGCAGAGGCAACTTAAATAACTCCTGAGCAGTTGGCACTAGAACAGAATACTTGGAATGACACCAAAGTTAACCAAGTCCAGCATATGTCCAAAGAGTTAAGTGTTTCATTTACTGTAGCATTCTGGGTGAGAAATTGGTTGCTGAAATCTTAAGACAGTGGTCTCAACCTTGGCTGCACATTGGAATCACCTGTAGGGTTTTAAAGCATCCAAATGGTAATTAACAGGCAGCAAAACTTCAGAACTAGTTCTGCATCTACTGTGCAAAGATCATGATTAACTGTCAAGACACTGGTAGAACAGAACAAGCAAAAGATTAAGAGTTCAAAAGTAAATGCAACCAATTTAACATGTAGTGTTATTAAAAAATTACAAAGGCCTAGACCAGCCTGGGCAACATGGTGA